Skip to main content
. 2020 Feb 9;9(2):397. doi: 10.3390/cells9020397

Figure 4.

Figure 4

Figure 4

TLR4 modulates BGN activity through NF-κB. (A,B) Promoter analysis of NF-κB (pGL4.31) and BGN promoter (−823/−1) after treatment with TLR4 inhibitor (TAK-242) for 1 d. Firefly luciferase activity was normalized to Renilla luciferase activity. ***, p < 0.001;**, p < 0.01 (n = 3 with mean ± SD shown). (C) Western blot experiments of BGN in LS174T after the administration of shRNA for TLR4. (D) ChIP/RT-qPCR results of p65 levels in BGN promoter regions in LS174T cells. (E) DAPA of the p65-binding site in the BGN (−656 to −627, CAGGCAAGCTGGGGAGCCCCCTGCCCCGTC) promoter. p65 binding to biotinylated oligonucleotides containing either wild-type (p65) or a mutated p65-binding (p65 mut) sequence was assayed by DNA affinity precipitation and analyzed by western blotting using nuclear extracts of HT-29 and LS174T cells. (F) Promoter analysis BGN promoter (−823/−1) and BGN p65 deletion promoter after transfection for 1 d. (G) BGN mRNA in LS174T cell after administration with Bay11-7085 (10 μg/ml) or TPCA-1 (5 μg/ml) for 6 h analyzed by RT-qPCR. (H) Western blot experiments of BGN in LS174T after administration with Bay11-7085 (10 μg/ml) or TPCA-1 (5 μg/ml) for 3 d. (I) ChIP/RT-qPCR results of H3K27me3 level in SLC26A2 and ST6GalNAc6 promoter regions in LS174T cells.