Key resources table.
Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|
---|---|---|---|---|---|
Gene (M. musculus) | Arl13b | MGI Cat# 6115585, RRID:MGI:6115585 | |||
Genetic reagent (M. musculus) | hennin | PMID:17488627 | MGI Cat# 3580673, RRID:MGI:3580673 | Arl13b null allele | |
Genetic reagent (M. musculus) | em1Tc (V358A) | This paper | MGI: 6256969 |
New CRISPR Point mutant | |
Genetic reagent (M. musculus) | FBV/NJ | Jackson Laboratory | Stock #001800 MGI:2163709 |
||
Cell lines (M. musculus) | Fibroblast (normal, embryonic) | This paper | Maintained in Caspary lab | ||
Antibody | Anti-Shh (Mouse Monoclonal) | Developmental Studies Hybridoma Bank | DSHB Cat# 5E1, RRID:AB_528466 | 1:5 | |
Antibody | Anti-Nkx2.2 (Mouse Monoclonal) | Developmental Studies Hybridoma Bank | DSHB Cat# 74.5A5, RRID:AB_531794 | 1:5 | |
Antibody | Anti-Hb9 (Mouse Monoclonal) | Developmental Studies Hybridoma Bank | DSHB Cat# 81.5C10, RRID:AB_2145209 | 1:5 | |
Antibody | Anti-Nkx6.1 (Mouse Monoclonal) | Developmental Studies Hybridoma Bank | DSHB Cat# F55A10, RRID:AB_532378 | 1:50 | |
Antibody | Anti-acetylated a-tubulin (Mouse Monoclonal) | Millipore Sigma | Sigma-Aldrich Cat# T6793, RRID:AB_477585 | 1:2500 | |
Antibody | Anti-Olig2 (Rabbit Polyclonal) | Millipore Sigma | Millipore Cat# AB9610, RRID:AB_570666 | 1:300 | |
Antibody | Anti-Arl13b (Mouse Monoclonal) | NeuroMab | UC Davis/NIH NeuroMab Facility Cat# 73–287, RRID:AB_11000053 | 1:1000 | |
Antibody | Anti-Arl13b (Rabbit Polyclonal | Protein Tech | Proteintech Cat# 17711–1-AP, RRID:AB_2060867 | 1:1000 | |
Antibody | Anti-Arl13b (Rabbit Polyclonal | PMID:17488627 | 503 | 1:1000 | |
Antibody | Anti-Arl13b (Rabbit Polyclonal | PMID:17488627 | 504 | 1:1000 | |
Antibody | Anti-Arl13b (Rabbit Polyclonal | PMID:17488627 | 505 | 1:1000 | |
Antibody | Anti-Smo (Rabbit Polyclonal) | K. Anderson | 1:1000 | ||
Antibody | Anti-IFT88 (Rabbit Polyclonal) | B. Yoder | 1:1000 | ||
Antibody | Anti-Arl3 (Rabbit Polyclonal) | PMID:8034651 | 1:1000 | ||
Antibody | Anti-Inpp5e (Rabbit Polyclonal) | Protein Tech | Proteintech Cat# 17797–1-AP, RRID:AB_2167120 | 1:150 | |
Antibody | Anti-Gli2 (Guinea Pig Polyclonal) | J. Eggenschwiler | 1:200 | ||
Antibody | Anti-Gli3 (Goat Polyclonal) | R and D | R and D Systems Cat# AF3690, RRID:AB_2232499 | 1:200 | |
Antibody | Anti-Ptch1 (Rabbit Polyclonal) | R. Rohatgi | 1:150 | ||
Antibody | Anti-Sufu (Goat Polyclonal) | Santa Cruz | Santa Cruz Biotechnology Cat# sc-10933, RRID:AB_671172 | 1:100 | |
Antibody | Alexa Fluor goat anti-mouse IgG2a 488 | ThermoFisher | Thermo Fisher Scientific Cat# A-21131, RRID:AB_2535771 | 1:300 | |
Antibody | Alexa Fluor goat anti-mouse IgG1 488 | ThermoFisher | Thermo Fisher Scientific Cat# A-21121, RRID:AB_2535764 | 1:300 | |
Antibody | Alexa Fluor goat anti-mouse Ig 488 | ThermoFisher | Molecular Probes Cat# A-11029, RRID:AB_138404 | 1:300 | |
Antibody | Alexa Fluor goat anti-mouse IgG 568 | ThermoFisher | Thermo Fisher Scientific Cat# A-11031, RRID:AB_144696 | 1:300 | |
Antibody | Alexa Fluor donkey anti-rabbit IgG 488 | ThermoFisher | Thermo Fisher Scientific Cat# A-21206, RRID:AB_2535792 | 1:300 | |
Antibody | Alexa Fluor donkey anti-rabbit IgG 555 | ThermoFisher | Thermo Fisher Scientific Cat# A-31572, RRID:AB_162543 | 1:300 | |
Antibody | Alexa Fluor goat anti-rabbit IgG 568 | ThermoFisher | Thermo Fisher Scientific Cat# A-11011, RRID:AB_143157 | 1:300 | |
Antibody | Alexa Fluor goat anti-mouse IgG2b 568 | ThermoFisher | Thermo Fisher Scientific Cat# A-21147, RRID:AB_2535783 | 1:300 | |
Antibody | Hoechst nuclear stain | Millipore Sigma | 94403 | 1:3000 | |
Sequence-based reagent | CRISPR gRNA | Millpore Sigma, this paper | CCAGTCAATACAGACGAGTCTA | ||
Sequence-based reagent | CRISPR donor oligo | Millpore Sigma, this paper | CCTATATTCTTCTAGAAAACAGTAAGAAGAAAACCAAGAAACTACGAATGAAAAGGAGTCATCGGGCAGAACCAGTGAATACAGACGAGTCTACTCCAAAGAGTCCCACGCCTCCCCAAC | ||
Sequence-based reagent | F-231-Cac8I | This Paper | PCR Primer AAGAATGAAAAGGAGTCAGCG | ||
Sequence-based reagent | REV-1 | This Paper | PCR PrimerTGAACCGCTAATGGGAAACT | ||
Peptide, recombinant protein | Arl13bWT-GST | This Paper | Purified from cells | ||
Peptide, recombinant protein | Arl13bV358A-GST | This Paper | Purified from cells | ||
Peptide, recombinant protein | Arl3 (human) | PMID:11303027 | Purified from cells | ||
Peptide, recombinant protein | Cas9 | Millipore Sigma | C120010 | 50 μg | |
Peptide, recombinant protein | Cac8I | New England Biolabs | R0579L | Restriction enzyme | |
Chemical compound, drug | Ciliobrevin-D | Millipore Sigma | 250401 | 30 μM | |
Chemical compound, drug | [3H]GDP | PerkinElmer Life Sciences | NET966 | 3000 cpm/pmol | |
Chemical compound, drug | GTPgS35 | PerkinElmer Life Sciences | NEG030H | ||
Software, algorithm | ImageJ software | ImageJ (http://imagej.nih.gov/ij/) | ImageJ, RRID:SCR_003070 | ||
Software, algorithm | GraphPad Prism software | GraphPad Prism (https://graphpad.com) | GraphPad Prism, RRID:SCR_002798 | Version 8.0.0 |