KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER |
|---|---|---|
| Antibodies | ||
| Rabbit Anti-Histone H2A.X, phospho (Tyr142) | Millipore | Cat# 07–1590, RRID:AB_1977237 |
| Rabbit Anti-Lamin B1 | Abcam | Cat# ab16048, RRID:AB_443298 |
| Mouse Anti-alpha Tubulin [DM1A] | Abcam | Cat# ab7291, RRID:AB_2241126 |
| Rabbit Anti-Histone H2A.X | Cell Signaling Technology | Cat# 2595, RRID:AB_10694556 |
| Mouse Anti-SYCP3 | Abcam | Cat# ab97672, RRID:AB_10678841 |
| Guinea pig Anti-H1t | [19] | N/A |
| Mouse Anti-Histone H2A.X, phospho (Ser139) | Millipore | Cat# 05–636, RRID:AB_309864 |
| Rabbit Anti-SYCP1 | Abcam | Cat# ab15090, RRID:AB_301636 |
| Rabbit Anti-TOPBP1 | [88] | N/A |
| Rabbit Anti-BRCA1 | [6] | N/A |
| Sheep Anti-Human MDC1 | Bio-Rad | Cat# AHP799, RRID:AB_323725 |
| Mouse Anti-RNA Polymerase II, C-Terminus Domain | Millipore | Cat# 05–952, RRID:AB_492629 |
| Rabbit Anti-Rad51 | Millipore | Cat# PC130, RRID:AB_2238184 |
| Rabbit Anti-ATR | Millipore | Cat# PC538, RRID:AB_2063178 |
| Mouse Anti-SCP3 conjugated with Alexa Fluor 488 | Abcam | Cat# ab205846, RRID: N/A |
| Mouse Anti-phospho Histone H2A.X (Ser139) conjugated with Alexa Fluor 647 | Millipore | Cat# 05–636-AF647, RRID: N/A |
| Rabbit Anti-MLH3 | [43] | N/A |
| Rabbit Anti-MLH1(H-300) | Santa Cruz Biotechnology | Cat# sc-11442, RRID:AB_2145332 |
| Rabbit Anti-ATRIP | [48] | N/A |
| Rabbit Anti- SIX6OS1 | [89] | N/A |
| Rabbit Anti-HORMAD2 | [90] | N/A |
| VeriBlot for IP Detection Reagent (HRP) | Abcam | N/A |
| Donkey Anti-Sheep IgG (H+L) Alexa Fluor 647 | Jackson ImmunoResearch Labs | Cat# 713-606-147, RRID:AB_2340752 |
| Goat Anti-Guinea Pig IgG (H+L) Alexa Fluor 555 | Thermo Fisher Scientific | Cat# A-21435, RRID:AB_2535856 |
| Donkey Anti-Mouse IgG (H+L) Alexa Fluor 555 | Thermo Fisher Scientific | Cat# A-31570, RRID:AB_2536180 |
| Donkey Anti-Mouse IgG (H+L) Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-21202, RRID:AB_141607 |
| Donkey Anti-Rabbit IgG (H+L) Alexa Fluor 555 | Thermo Fisher Scientific | Cat# A-31572, RRID:AB_162543 |
| Donkey Anti-Rabbit IgG (H+L) Alexa Fluor 488 | Thermo Fisher Scientific | Cat# A-21206, RRID:AB_2535792 |
| Donkey Anti-Sheep IgG (H+L) DyLight 488 | Jackson ImmunoResearch Labs | Cat# 713-486-147, RRID:AB_2340741 |
| Goat Anti-Rabbit IgG (H+L) antibody F(ab’)2 Fragment Cy3 | Jackson ImmunoResearch Labs | Cat# 111-166-003, RRID:AB_2338007 |
| Donkey Anti-Guinea Pig IgG (H+L) antibody F(ab’)2 Fragment Alexa Fluor 647 | Jackson ImmunoResearch Labs | Cat# 706-606-148, RRID:AB_2340477 |
| Chemicals, Peptides, and Recombinant Proteins | ||
| Phosphatase inhibitor cocktail 2 | Sigma | Cat# P5726–5ML |
| cOmplete™ Protease Inhibitor Cocktail | Sigma | Cat# 11836145001 |
| StartingBlockTM T20 (TBS) Blocking Buffer | ThermoFisher Scientific | Cat# 37543 |
| Restore™ Western Blot Stripping Buffer | ThermoFisher Scientific | Cat# 21059 |
| Critical Commercial Assays | ||
| In Situ Cell Death Detection Kit, Fluorescein | Sigma | Cat# 11684795910 |
| Deposited Data | ||
| RNA-seq data (Scml2KO) | [70] | GEO: GSE55060 |
| Experimental Models: Organisms/Strains | ||
| Mouse: H2ax-Y142A | This study | N/A |
| Mouse: Mdc1KO | [52] | N/A |
| Oligonucleotides | ||
| Primer: H2ax-Y142A WT Forward: CGC AGG CCT CTC AGG AGT | This study | N/A |
| Primer: H2ax-Y142A KI Forward: CGC AGG CCT CTC AGG AGG CT | This study | N/A |
| Primer: H2ax-Y142A Common Reverse: CTG CGG AGG GAC TAA CCT TC | This study | N/A |
| sgRNA for generating H2ax-Y142A: GCCTCTCAGGAGTACTGAGG | This study | N/A |
| Software and Algorithms | ||
| BioWardrobe Experiment Management Platform | [92] | https://biowardrobe.cchmc.org/frontend/Home |
| Prism 8 | GraphPad software | https://www.graphpad.com/ |