Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
The Oligonucleotide primer sequences used in the study showing the annealing positions and their nucleotide sequences [28].
| Oligonucleotide Sense | Nucleotide Sequence 5′-3′ | Uses | Position on Genome |
|---|---|---|---|
| JW12 (+) | ATGTAACACC(C/T)CTACAATTG | cDNA synthesis, PCR, hnPCR | 55–74 |
| 001lys (+) | ACGCTTAACGAMAAA | cDNA synthesis | 1–15 |
| 304 (-) | TTGACAAAGATCTTGCTCAT | PCR and sequencing | 1514–1533 |
| 550B (-) | GTRCTCCARTTAGCRCACAT | hnPCR | 647–666 |
