Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primer sequences of reference (ACT) and target (CSD) genes used in qRT-PCR
| Gene name | Accession number | Primer sequence (5′ → 3′) | Primer length (nt) | Ta (°C) | Product size | |
|---|---|---|---|---|---|---|
| CSD | XM_007147050.1 | Forward | ACAGCCAGATTCCTCTTACT | 20 | 56 | 153 |
| Reverse | GCAGACCAATGATACCACAG | 20 | ||||
| ACT | KF033476.1 | Forward | GAGACCTTCAACACTCCTGCTA | 22 | 56 | 131 |
| Reverse | CCTTCATAGATAGGAACCGTGT | 22 |
