| Antibodies |
| Rabbit polyclonal anti-zebrafish Pbx |
[77] |
N/A |
| Rabbit polyclonal anti-zebrafish NF-YA |
This paper |
N/A |
| Bacterial and Virus
Strains |
| Subcloning Efficiency DH5α competent
cells |
ThermoFisher Scientific |
18265–017 |
| OneShot Top10 chemically competent cells |
ThermoFisher Scientific |
C404003 |
| Chemicals, Peptides, and
Recombinant Proteins |
| Protein-A Dynabeads |
ThermoFisher Scientific |
10001D |
| NotI |
New England Biolabs |
R0189S |
| XhoI |
New England Biolabs |
R0146S |
| BglII |
New England Biolabs |
R0144S |
| Critical Commercial
Assays |
| mMESSAGE mMACHINE SP6 Transcription Kit |
ThermoFisher Scientific |
AM1340 |
| RNeasy Mini Kit |
Qiagen |
74104 |
| DIG DNA Labeling Mix |
Millipore Sigma |
11277065910 |
| Trizol |
ThermoFisher Scientific |
15596026 |
| GlycoBlue |
ThermoFisher Scientific |
AM9515 |
| MicroPure DiaChIP Columns |
Diagenode |
C03040001 |
| dsDNA HS Assay |
ThermoFisher Scientific |
Q32851 |
| MicroPlex Library Preparation Kit v2 |
Diagenode |
C05010012 |
| OneTaq Hot Start DNA Polymerase |
New England Biolabs |
M0481L |
| pCR8/GW/TOPO |
ThermoFisher Scientific |
45–0642 |
| Plasmid Midi/Maxi Kit |
Qiagen |
12143/12163 |
| LR Clonase II Plus Enzyme Mix |
ThermoFisher Scientific |
12538–120 |
| High Capacity cDNA Reverse Transcription
Kit |
ThermoFisher Scientific |
4368814 |
| SYBR Green qPCR Master Mix |
Bimake |
B21203 |
| Deposited Data |
| Pbx4 ChIP-seq and Inputs in 3.5 hpf zebrafish
embryos |
This paper |
E-MTAB-8137 |
| NF-YA ChIP-seq and Inputs in 3.5 hpf zebrafish
embryos |
This paper |
E-MTAB-8137 |
| PBCAB and GFP RNA-seq in 12 hpf zebrafish
embryos |
This paper |
GSE133459 |
| NF-YA DN and GFP RNA-seq in 12 hpf zebrafish
embryos |
This paper |
GSE133459 |
| Prep1 ChIP-seq and Inputs in 3.5 hpf zebrafish
embryos |
[23] |
E-MTAB-5967 |
| H3K27ac ChIP-seq in dome zebrafish embryos,
WIG files |
[79] |
GSM915197 |
| H3K4me1 ChIP-seq in dome zebrafish embryos,
WIG files |
[79] |
GSM915193 |
| H3K4me3 ChIP-seq in dome zebrafish embryos,
WIG files |
[79] |
GSM915189 |
| H3K27ac ChIP-seq in 80% epiboly zebrafish
embryos, WIG files |
[79] |
GSM915198 |
| H3K4me1 ChIP-seq in 80% epiboly zebrafish
embryos, WIG files |
[79] |
GSM915194 |
| H3K4me3 ChIP-seq in 80% epiboly zebrafish
embryos, WIG files |
[79] |
GSM915190 |
| MNase-seq in 4.5hpf zebrafish embryos, WIG
files |
[80] |
GSM1081554 |
| Experimental Models:
Organisms/Strains |
| Strain EKW |
Ekkwill breeders |
http://www.ekkwill.com/ |
| Oligonucleotides |
| Gapdh forward primer TGCTGGTATTGCTCTCAACG |
|
N/A |
| Gapdh reverse primer AACAGCAAAGGGGTCACATC |
|
N/A |
| GFP forward primer ATGGTGAGCAAGGGCGAGGAG |
|
N/A |
| GFP reverse primer TTACTTGTACAGCTCGTCCATG |
|
N/A |
| Recombinant DNA |
| NF-YA DN in pCS2+ |
[23] |
N/A |
| PBCAB in pCS2+MT |
[33] |
N/A |
| tcf3a element in E1b-GFP-Tol2 |
This paper |
N/A |
| tle3a element in E1b-GFP-Tol2 |
This paper |
N/A |
| dachb element in E1b-GFP-Tol2 |
This paper |
N/A |
| fgf8a element in E1b-GFP-Tol2 |
This paper |
N/A |
| yap1 element in E1b-GFP-Tol2 |
This paper |
N/A |
| pax5 element in E1b-GFP-Tol2 |
This paper |
N/A |
| her6 element in E1b-GFP-Tol2 |
This paper |
N/A |
| prdm14 element in E1b-GFP-Tol2 |
This paper |
N/A |
| tcf3a element in pCR8 |
This paper |
N/A |
| tle3a element in pCR8 |
This paper |
N/A |
| Mutant tcf3a element in pCR8 |
This paper |
N/A |
| Mutant tle3a element in pCR8 |
This paper |
N/A |
| pTransgenesis p1 gamma-crystallin::venus
GFP |
[81] |
N/A |
| pTransgenesis p3 sv40 minimal promoter::
Katushka RFP |
This paper |
N/A |
| pTransgenesis pDest4
Tol2/I-SceI-CH4-SAR/I-SceI/Tol2/P-element |
[81] |
N/A |
| Software and
Algorithms |
| FastQC |
Babraham Institute |
https://www.bioinformatics.babraham.ac.uk/projects/fastqc/
RRID:SCR_014583 |
| FastQ Screen |
Babraham Institute |
https://www.bioinformatics.babraham.ac.uk/projects/fastq_screen/
RRID:SCR_000141 |
| Trimmomatic v0.32 |
[42] |
http://github.com/timflutre/trimmomatic
RRID:SCR_011848 |
| Bowtie v2.2.3 |
[43] |
http://github.com/BenLangmead/bowtie2
RRID:SCR_005476 |
| SAMtools v0.1.19 |
[45] |
http://github.com/samtools/samtools RRID:SCR_002105 |
| MACS v2.1.0.20140616 |
[46] |
http://github.com/taoliu/MACS |
| RSEM v1.2.28, Dolphin, Biocore, University of
Massachusetts Medical School |
[40] |
http://www.umassmed.edu/biocore/introducing-dolphin/
RRID:SCR_013027 |
| DESeq2, Dolphin, Biocore, University of
Massachusetts Medical School |
[41] |
http://www.umassmed.edu/biocore/introducing-dolphin/
RRID:SCR_015687 |
| DEBrowser v v1.12.2 |
[82] |
http://github.com/UMMS-Biocore/debrowser |
| Galaxy web interface |
[47] |
http://usegalaxy.org RRID:SCR_006281 |
| BedTools, Galaxy |
[48] |
http://usegalaxy.org RRID:SCR_006646 |
| DeepTools, Galaxy |
[55] |
http://usegalaxy.org |
| MEME-ChIP |
[53,
54] |
http://meme-suite.org/tools/meme-chip
RRID:SCR_00178 |
| DAVID v6.8 |
[51,
52] |
http://david.ncifcrf.gov/ RRID:SCR_001881 |
| GREAT v3.0.0 |
[49,
50] |
http://bejerano.stanford.edu/great/public/html
RRID:SCR_005807 |
