Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers for amplifying the candidate genes.
| Primer name | Sequence |
| mrcB1 | tcgatggggatccgagctaggaggaattcaccatcatggccgggaatgaccg |
| mrcB2 | catatggtaccagctgcattaattactaccaaacatatccttgatcca |
| lpoB1 | tcgatggggatccgagctaggaggaattcaccatcatgacaaaaatgagtcgctacgc |
| lpoB2 | catatggtaccagctgcattattgctgcgaaacggcac |
| ybgC1 | tcgatggggatccgagctaggaggaattcaccatcgtgaatacaacgctgtttcga |
| ybgC2 | catatggtaccagctgcatcactgcttaaactccgcga |
