Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Primers used in Quantitative reverse transcription‐polymerase chain reaction analysis
| Primer Sequences (written 5′ to 3′) | |
|---|---|
| miR‐223, forward | GCGGCGGTGTCAGTTTGTC |
| miR‐223, reverse | GTGCAGGGTCCGAGGT |
| cel‐miR‐39, forward | CAGAGTCACCGGGTGTAAAT |
| cel‐miR‐39, reverse | CCAGTGCGTGTCGTGGAGTC |
