Skip to main content
. 2019 Jun 6;164(9):2315–2320. doi: 10.1007/s00705-019-04304-y

Table 1.

List of primers used in this study. Nucleotide positions refer to the sequence of the canine protoparvovirus 2 strain ITA/2011/297-15 (GenBank accession no. MF198244

Oligonucleotide Position Sequence (5′ to 3′) Sense References
CCPV-L3 F 2938-2964 TGAACAAGAAATAGACAACATTGTCAT + Martella et al., 2018 [3]
CCPV-L3 R 3012-3035 AAAGAGCAGTTAGGTCATTGTTGT - Martella et al., 2018 [3]
CCPV-165 F 2872-2891 CTGGTTTAATCCAGCAGACT + Martella et al., 2018 [3]
CCPV-371 R 3060-3079 TGAAGACCAAGGTAGTAGGT - Martella et al., 2018 [3]
CCPV-1409 F 2411-2432 TCATATTCCTGGAGAAACATCA + Diakoudi et al., 2019 [7]
CCPV-1414 R 3351-3372 ATATGTCTGTTAGATTGCCAGT - Diakoudi et al., 2019 [7]
CCPV-1571 R 4201-4219 TTATAGAGTAATATTAGGC - Diakoudi et al., 2019 [7]