Table 1.
Primers used for amplification of HRV VP4/VP2 and 5′UTR regions.
| 5′–3′ sequences | Region | Orientation | Positiona |
|---|---|---|---|
| CCGGCCCCTGAATGYGGCTA | VP4/VP2 | Outer sense | 458 |
| ACATRTTYTSNCCAAANAYDCCCAT | VP4/VP2 | Outer antisense | 1125 |
| ACCRACTACTTTGGGTGTCCGTG | VP4/VP2 | Inner sense | 547 |
| TCWGGHARYTTCCAMCACCANCC | VP4/VP2 | Inner antisense | 1087 |
| HCAAGYACTTCTGTYWCCCCSG | 5′UTR | Outer sense | 178 |
| GAAACACGGACACCCAAAGTAGT | 5′UTR | Outer antisense | 573 |
| TTAGCCRCATTCAGGGGCCGG | 5′UTR | Inner antisense | 477 |
a
The 5′ base position numbered according to the HRV-B serotype 14 genome (GenBank accession number NC_001490).