Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Ten shared genes in various species and predicted site sequences in the mouse Ipr1 promoter
| Gene name | Starta | Enda | Strand | Predicted site sequence |
|---|---|---|---|---|
| SP1 | −75 | −65 | −1 | CCTCCACCCCT |
| ZNF354C | −71 | −66 | −1 | CTCCAC |
| KLF5 | −74 | −65 | −1 | CCTCCACCCC |
| ELF5 | −274 | −266 | 1 | CACTTCCTA |
| HLTF | −179 | −170 | 1 | ATCCTTTGCC |
| SPIB | −93 | −87 | 1 | TGGGGAA |
| MEIS1 | −164 | −150 | 1 | GCCTGTCACTCCACT |
| NFIC | −375 | −370 | −1 | CTGGCA |
| RHOXF1 | −182 | −176 | 1 | TAATCC |
| IRF3 | −13 | +7 | 1 | GATCACTTTCATTTTTCTTTT |
Distance from TSS (nucleotides).
