Table 1.

Primers and probe used for Bocavirus real-time PCR.

Target	Sequence (5′ → 3′)	Function	Product size	Primer source
HBoV	CACKCCCAGGAARTGACGTAT	Forward primer	118 bp	This study
3′ non-coding region	CCAGAGATGTTCACTCGCCGGA	Reverse primer
	TCAGACTGCATCCGGTCTa	Probe

Platinum ^® Quantitative PCR SuperMix-UDG Invitrogen enzyme (Cat.No. 11730-005) was used for PCR amplification of the above targets in a monoplex format in a final 25ul volume reaction (containing 20 ul of master mix and 5ul of nucleic acid extract) with 3 mM MgCl2, 400 nM primers and 120 nM probe concentration.

Cycling conditions were 50 °C for 2 min, 95 °C for 2 min, 40 cycles at 95 °C for 15 s and 60 °C for 1 min and acquiring on FAM for both assays.

^a = MGB probe. Fluorophore = FAM, Quencher = NFQ (Life technologies).