Table 1.

List of primers used for conventional RT-PCR, nested PCR and SYBR Green real-time RT-PCR assay for the detection and quantitation of bovine and porcine toroviruses in the fecal specimens from diarrheic calves and piglets.

Primer name	Sequence (5′–3′)a	Annealing temperature (°C)	Product size (bp)	Gene location	Source or references
Conventional RT-PCRb
BToV	F: TTCTTACTACACTTTTTGGA R: ACTCAAACTTAACACTAGAC	43	603	25989–26005c 26438–26458c	Park et al. (2008)
PToV	F: GCCTTTTCCAGACCAGGCCC R: GCAAACCATTGTCCATTAACAC	55	555	21–40d 554–575d	Shin et al. (2010)
Nested PCRb
BToV	F: TATGTACTATGTTTCCAGCT R: CCAACACAAATCCGCAACGC	43	409	25989–26005c 26298–26315c	Park et al. (2008)
PToV	F: ATCTTTGGCAATTGCTTA R: ACCACGAATAGCAATT	55	175	231–248d 390–405d	Shin et al. (2010)
SYBR Green real-time RT-PCRe
BToV	F: TTACTGGYTATTGGGCMYT R: AAAGGRGTGCAGTGWAGCTT	48	187	26029–26047c 26196–26215c	This study
PToV				272–290d 439–458d

^aF: forward primer for conventional RT-PCR, nested PCR, and SYBR Green real-time RT-PCR; R: reverse primer for Conventional RT-PCR, nested PCR, and SYBR Green real-time RT-PCR.

^bAll the procedure of RNA extraction, conventional RT-PCR and nested PCR were performed as described previously (Cho et al., 2001, Park et al., 2008).

^cPosition as counted from the start codon of the complete genome of bovine Breda strain.

^dPosition as counted from the start codon of the porcine torovirus Markelo strain M gene.

^eUniversal primer pair for SYBR Green real-time RT-PCR is designed from the M gene of the bovine and porcine torovirus strains reported in Genbank database as follows; AY427798, AJ575377, DQ778043, AB285126, DQ778053, AJ575374, DQ778048, DQ778049, AJ575371, AJ575370, AJ575368, AJ575369, GU181240, GU181241, GU181244, GU181246, DQ778045.