Table 4.
The spotting oligonucleotides
| Number of sequences | Spotting sequences (5′ → 3′) |
|---|---|
| Site 1 | |
| Positive sequence | GATGATCGACGAGACACTCTCGCCA (A)15-NH2 |
| Negative sequence | CGGTCGACGAGCTGCCGCGCAAGAT (A)15-NH2 |
| Contrastive sequence | GACATTCGCGATCGCCGCCCGCTTT (A)15-NH2 |
| Site 2 | |
| Positive sequence | CGGTATCGCGACCGCATCCCAATCT (A)15-NH2 |
| Negative sequence | GCTCGAAGAGGCGCTACAGATCCTC (A)15-NH2 |
| Contrastive sequence | CACCGCCAGCTCGGCTTCGAGTTCG (A)15-NH2 |
| Site 3 | |
| Positive sequence | GAACCTTTCGCTTCACCGGCCGATC (A)15-NH2 |
| Negative sequence | TTTCGGCACGCGCGGGATCACCATC (A)15-NH2 |
| Contrastive sequence | CTCGGTGGTGCTGACGGTGCAATCC (A)15-NH2 |
| Site 4 | |
| Positive sequence | TCAACGTGCCAGCGCCGTCCTGGGA (A)15-NH2 |
| Negative sequence | GCGAAGGAACTCGACGTGGACGCCG (A)15-NH2 |
| Contrastive sequence | CGGGGATACCGATCTCGGGCGCACA (A)15-NH2 |
| Site 5 | |
| Positive sequence | GGAGCTTACGCCATCACGATGCGAT (A)15-NH2 |
| Negative sequence | CGTGGCGGTGCGGAGTTTCCCCGAA (A)15-NH2 |
| Contrastive sequence | CGATCCAACGCACTGGCCAAACCTA (A)15-NH2 |
| Site 6 | |
| Positive sequence | CTGAATCCTCCAACCGGGTTGTCGA (A)15-NH2 |
| Negative sequence | TTCGGCGCTGGCGTAAAGCTTTTGG (A)15-NH2 |
| Contrastive sequence | GTAAATCTCCAGCGGAAGGGTACGG (A)15-NH2 |
| Spotting control sequence | Cy3-CCGGCTTTGAACTGCTCACCGATCT (A)15-NH2 |
| Hybridization control | ACTACGCAACACCGAACGGATACCC (A)15-NH2 |