TABLE 1.
Key reproducibly occurring mutations detected in the final populations and clones of S. aureus TCH1516 after adaptive laboratory evolution in RPMI+
| Genea | Specific function | Mutation typeb | Protein and nucleotide changec |
Strain(s)d |
|---|---|---|---|---|
| apt | Adenine phosphoribosyl transferase | SNP | D119E (GAT→GAA) | 8 |
| SNP | H104Y (CAC→TAC) | 1 | ||
| SNP | P76S (CCT→TCT) | 6p | ||
| SNP | G73D (GGC→GAC) | 4 | ||
| SNP | A67V (GCT→GTT) | 2p, 6, 7 | ||
| SNP | A67T (GCT→ACT) | 5 | ||
| SNP | V66L (GTA→CTA) | 1p | ||
| SNP | V41L (GTA→TTA) | 2 | ||
| mntA (znuC_1) | Manganese ABC transporter | SNP | L11I (TTA→ATA) | 4 |
| SNP | L2I (TTA→ATA) | 2p | ||
| SNP | M1M (TTG→ATG)† | 3, 5, 6p, 7 | ||
| mntA, mntR (znuC_1, ideR) | Manganese ABC transporter/Mn-dependent transcriptional regulator MntR | SNP | A→G, intergenic (−1/−121) | 4 |
| SNP | C→T, intergenic (−2/−120) | 2p | ||
| INS | (GTTTAGGCTAACCTAATTAA)1→2, intergenic (−43/−79) | 3, 5, 6p, 7 | ||
| stk1 (prkC) | Serine/threonine-protein kinase | SNP | A124P (GCG→CCG) | 4 |
| SNP | V470D (GTT→GAT) | 1 | ||
| cspA_2 | Cold shock protein CspA | SNP | A60V (GCT→GTT) | 2 |
| DEL | Δ1 bp, coding (34/201 nt) | 4 | ||
| dynA (RS07370) | Bacterial dynamin-like protein | SNP | Q1098E (CAA→GAA) | 2 |
| SNP | S618T (TCT→ACT) | 6 | ||
| recJ | Single-stranded-DNA-specific exonuclease RecJ | SNP | S757S (TCG→TCT) | 3 |
| SNP | A348V (GCA→GTA) | 8 | ||
| lyrA | Lysostaphin resistance protein A | SNP | L48L (CTA→CTT) | 1 |
| DEL | Δ1 bp, coding (1210/1260 nt) | 5 | ||
| SUB | 2 bp→AT, coding (1216 − 1217/1260 nt) | 5 | ||
a
The gene locus tag corresponds to USA300HOU_RSXXXXX. The gene nomenclature provided by prokka annotation, reflected in the mutation analysis, is shown in the parentheses.
b
SNP, single nucleotide polymorphism; INS, insertion; DEL, deletion; SUB, substitution.
c
nt, nucleotide; †, mutation led to formation of a start codon.
d
p denotes population.