. 2013 Sep 5;95(2):229–234. doi: 10.1016/j.mimet.2013.08.017

Table 1.

Primers used for designing the APC synthetic inserts, performing PCR of the targets within APCs, and RT-PCR of in vivo reference positive controls^a.

Target	Primer ID	5′-3′ sequence	Size of target amplicons (bp)			Reference
Target	Primer ID	5′-3′ sequence	Reference positive control^a	Optimal APC	Sub-optimal APC	Reference
Barley yellow dwarf virus	BYDV-F1	CAACACCGGAACCGAAAC	128	121	123	This study
Barley yellow dwarf virus	BYDV-R1	TGGAGTGCCGATATACTCAAA	128	121	123	This study
Soil-borne wheat mosaic virus	SBWMV-F1	ATCATTGTCCCGCTGTTCTC	92	120	122	This study
Soil-borne wheat mosaic virus	SBWMV-R1	GCACACCTGCTTCTTTCCA	92	120	122	This study
Wheat streak mosaic virus	WSMV-F2	GAACTCAAAGCACCCACAA	218	122	122	Arif et al. (unpublished)
Wheat streak mosaic virus	WSMV-R2	ACCACCACATCAACCTCCTC	218	122	122	Arif et al. (unpublished)
Triticum mosaic virus	TriMV-F1	AACACAACGCACGACTTTCT	198	122	122	Arif et al. (unpublished)
Triticum mosaic virus	TriMV-R1	GCAACCCATTCCTTCTTCC	198	122	122	Arif et al. (unpublished)
NADH dehydrogenase subunit 5	Nad5-s	GATGCTTCTTGGGGCTTCTTGTT	181	124	124	Menzel et al. (2002)
NADH dehydrogenase subunit 5	Nad5-as	CTCCAGTCACCAACATTGGCATAA	181	124	124	Menzel et al. (2002)

Infected plant tissue.