Table 1.

Sequences, genome location and the references of primers used in this study.

	Primers	Sequences 5′–3′	Gene	Position in the sequenceψ	Reference
1	r-N1221	CATTCTCTCCTAGAGCTGCA	N	27,075–27,094	Designed by researcher
2	f-N784	AATTTTGGTGATGACAAGATGA	N	26,626–26,647	(Farsang et al., 2002)
3	f-XCE1+	CACTGGTAATTTTTCAGATGG	S1	21,069–21,089	(Adzhar et al., 1997)
4	r-XCE2−	CTCTATAAACACCCTTACA	S1	21,507–21,526	(Adzhar et al., 1997)
5	f-S1Uni2+	(CCC)aAATTTAAAACTGAACA	S1	20,298–20,314	(Adzhar et al., 1996)
7	rS1982	ACCAGCCGGTTTAGTAGAAG	S1	22,331–22,350	Designed by researcher
6	f-col VI a2	ACACGCGAGGCGCTGCCCGGGAC	Col. VI α 2	1978–2000	Designed by researcher
8	r-col VI a2	ACAGGAGGTAACAGGTTCATA	Col. VI α 2	5311–5332	Designed by researcher

^aThe nucleotides CCC at the 5′ end of oligonucleotide f-SlUni2 + are non-template residues, i.e. do not correspond to IBV sequence. They were included to increase the annealing temperature; ψ according to IBV sequence (accession no. NC_001451) and collagen sequence (accession no. X56595).