Table 1.

P-PMOs and their target sites in PRRSV RNA^a,b

P-PMO name	P-PMO sequence (5′–3′)	Nucleotide position of P-PMO target in PPRSV RNA, and P-PMO orientation	P-PMO target region in PRRSV
5UP1	CATAGAGCCAACACCTATACG	3–23, antisense	5′-terminus of genomic RNA
NSP1	CCCAAAAACTTGCTGCACGG	66–85, sense	3′-end-region of negative-sense (antigenome) RNA
TRS-Pc,d	GACATGGTTAAAGGGGTGGAG	173–193, antisense	TRS-region and 5′-end of ORF1a
TRSsg-Pd	GGTTAAAGGGGTGGAGAGACCG	167–188, antisense	TRS and TRS 5′-flanking sequence
ORF1aPc	CCGATCAAGTATCCCAGACAT	189–209, antisense	Translation initiation region of ORF1a
3UP1	GTCGCCCTAATTGAATAGGTG	15032–15052, antisense	3′-end-region of genomic RNA
CP1	GATATACACAACACCCAATT	None	Random sequence negative control

^aThe peptide R₅F₂R₄ is conjugated to the 5′-end of all the P-PMOs in this study.

^bP-PMO design was based on PRRSV VR2385 genomic RNA.

^cThe underlined nucleotides correspond to the AUG translation initiation codon of PRRSV ORF1a.

^dThe italicized nucleotides correspond to the ‘transcription regulatory sequence’.