TABLE 1.
Primer pairs used for PCR amplification
| Organism | Targeta | Primer name | Nucleotide sequence (5′ to 3′) | Amplified fragment (bp) | Annealing temp (°C) | Reference or source |
|---|---|---|---|---|---|---|
| Ixodes ricinus | ITS2 | ITS2-outF | CTCTTTGAACGCACATTGCG | ∼590b | 48 | This study |
| ITS2-outR | AGACTGACGGAAGGCTACGA | This study | ||||
| ITS2-F | CTGTGTGAGGGTCGGATCAT | ∼315b | 60 | This study | ||
| ITS2-R | CGTTTCACATCTCCAACGCA | This study | ||||
| Borrelia miyamotoi | glpQ | Q1 | CACCATTGATCATAGCTCACAG | 633 | 48 | 8 |
| Q2 | CTGTTGGTGCTTCATTCCAGTC | 8 | ||||
| Q3 | GCTAGTGGGTATCTTCCAGAAC | 399 | 48 | 8 | ||
| Q4 | CTTGTTGTTTATGCCAGAAGGGT | 8 | ||||
| Gap 1 | Gap1-2 F | ACCAAGATTCCTCAATTGCTC | 758 | 58–50 | This study | |
| Gap1-2 R | GATGAAAGCTACTGCTTCAATTGA | This study | ||||
| Gap 2 | Gap2-2 F | CAATCTTGTCGTTCAGTGTATC | 878 | 58–50 | This study | |
| Gap2-2 R | GAATATAAAACCCTAGCAACAAGC | This study | ||||
| Gap 3 | Gap3-1 F | CAAGAGTTGTTAGCAGGACTTCA | 932 | 58–50 | This study | |
| Gap3-1 R | AGCAGCAGAACTAATTGTAA | This study | ||||
| Gap 4 | Gap4-2 F | AGAGAAGGTAGTTGGGGCT | 470 | 58–50 | This study | |
| Gap4-2 R | GTAGCTTTCTCAAGTTGCT | This study |
a
Amplification steps for ITS2 and glpQ were as follows: 94°C for 1 min; 40 cycles of 94°C for 30 s, with annealing at 48°C (or 60°C) for 30 s and 72°C for 1 min 45 s; and 72°C for 7 min. For gaps 1 to 4, conditions were as follows: 95°C for 3 min; 9 cycles of a touchdown step with denaturation at 94°C for 30 s, with the annealing temperature reduced from 58°C to 50°C, and extension at 72°C for 1 min, followed by 35 cycles of denaturation at 94°C and annealing at 50°C, both for 30 s, and extension at 72°C for 1 min; and a final extension step at 72°C for 5 min.
b
The length varies slightly among tick individuals.