Table 1.
Nucleotide sequences of primers and fluorogenic probe
Primer or probea | Sequence (5′ → 3′)b | Tm (°C)c | Locationd within the genome | Size (bp) | GC content (%) |
---|---|---|---|---|---|
Forward primer | CCCAAGCTGATGACACCTTTG | 59.2 | 2869–2889 | 21 | 52.38% |
Reverse primer | AATCCAGAGGCTCATCCTGGT | 58.6 | 2945–2965 | 21 | 52.38% |
Probe | FAM-CGCGTAGAACTGTGACA ACAACGCTGA-TAMRA | 68.8 | 2915–2941 | 27 | 51.85% |
Primers and probe were designed by using Primer Express V2.0 software.
FAM fluorescent reporter dye and with TAMRA the quencher dye.
Melting temperature estimated by Primer Express 2.0 primer test document, dyes are not accounted for in the calculations.
Nucleotide positions are based on GenBank EF641008.