Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Potential novel bovine miRNAs found with precursor co-ordinates in bovine genome.
| Human ortholog | Mature sequence | MFE* | Bovine genome coordinates¶ |
|---|---|---|---|
| hsa-miR-548d-5p | AAAAGTAATTGTGGTTTTTGCC | −11.3 | NC_037357.1:11388342..11388406- |
| hsa-miR-2113 | ATTTGTGCTTGGCTCTGTCAC | −26.8 | NC_037336.1:51693442..51693504- |
| hsa-miR-1244 | AAGTAGTTGGTTTGTATGAGATGGTT | −12.2 | NC_037329.1:47897067..47897155+ |
*MFE = mean free energy.
¶Bovine genome version ARS-UCD1.2.
