KEY RESOURCES TABLE
| REAGENT or RESOURCE | SOURCE | IDENTIFIER | |||||||||||
|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
| Antibodies | |||||||||||||
| K14 antibody for IF (section) | Covance | Cat #PRB-155P RRID:AB_292096 | |||||||||||
| K10 antibody for IF (section) | Covance | Cat #PRB-159P RRID:AB_291580 | |||||||||||
| Loricrin antibody for IF (section) | Covance | Cat #PRB-145P RRID:AB_292095 | |||||||||||
| Collagen VII antibody for IF (section) | Millipore | Cat #MAB1345 RRID:AB_11210494 | |||||||||||
| Anti-K14-FITC antibody for FACS | Millipore | Cat #CBL197F RRID:AB_11212136 | |||||||||||
| Anti-K18-FITC antibody for FACS | Novus | Cat #NB120–7797 RRID:AB_2133302 | |||||||||||
| Purified anti-human CD16 antibody for FACS | BioLegend | Cat #302002 RRID:AB_314202 | |||||||||||
| Purified anti-human CD32 antibody for FACS | BioLegend | Cat #303202 RRID:AB_314334 | |||||||||||
| K14 antibody for IF | BioLegend | Cat #SIG-3476–100 RRID:AB_10718041 | |||||||||||
| K18 antibody for IF | R&D | Cat #AF7619 RRID: N/A | |||||||||||
| AP-2γ antibody for IF | Cell Signaling | Cat #2320S RRID:AB_10695101 | |||||||||||
| p63 antibody for IF | GeneTex | Cat #GTX102425 RRID:AB_1952344 | |||||||||||
| ITGA6 antibody for IF | Millipore | Cat #MAB1378 RRID:AB_11210794 | |||||||||||
| TFAP2C antibody for ChIP | Santa Cruz | Cat #sc-8977X RRID:AB_2286995 | |||||||||||
| H3K4m3 antibody for ChIP | Active Motif | Cat #39159 RRID:AB_2615077 | |||||||||||
| H3K4m1 antibody for ChIP | Abcam | Cat #ab8895 RRID:AB_306847 | |||||||||||
| H3K27ac antibody for ChIP | Active Motif | Cat #39133 RRID:AB_2561016 | |||||||||||
| H3K27m3 antibody for ChIP | Active Motif | Cat #39155 RRID:AB_2561020 | |||||||||||
| H3K9m3 antibody for ChIP | Abcam | Cat #ab8898 RRID:AB_306848 | |||||||||||
| Chemicals, Peptides, and Recombinant Proteins | |||||||||||||
| BMP4 | R&D Systems | Cat #314-BP-050 | |||||||||||
| RA | Sigma | Cat #R2625 | |||||||||||
| Doxycycline | Sigma | Cat #D9891 | |||||||||||
| Blasticidin | ThermoFisher | Cat #A1113903 | |||||||||||
| 16% Formaldehyde solution | ThermoFisher | Cat #28906 | |||||||||||
| Essential 8 (E8) Medium | Life Technologies | Cat #A1517001 | |||||||||||
| Essential 6 (E6) Medium | Life Technologies | Cat #A1516401 | |||||||||||
| Defined Keratinocyte-SFM | Life Technologies | Cat #10744–019 | |||||||||||
| AggreWell EB Formation Medium | StemCell Technologies | Cat #05893 | |||||||||||
| Knockout DMEM/F12 | GIBCO/invitrogen | Cat #12660–012 | |||||||||||
| Knockout Serum Replacement | GIBCO/invitrogen | Cat #10828–028 | |||||||||||
| MEM Non-Essential Amino Acids Solution 10 mM (100X) | GIBCO/invitrogen | Cat #11140050 | |||||||||||
| EmbryoMax® ES Cell Qualified 2-Mercaptoethanol (100X) | Millipore | Cat #ES-007-E | |||||||||||
| L-Glutamine-200mM 200X | GIBCO/invitrogen | Cat #25030–081 | |||||||||||
| KGM Keratinocyte Growth Medium | Lonza | Cat #CC-3111 | |||||||||||
| Corning PureCoat ECM Mimetic 6-well Collagen I Peptide Plate |
Corning | Cat #356270 | |||||||||||
| BD Matrigel hESC-qualified Matrix | Fisher | Cat #354277 | |||||||||||
| CELLstart Substrate | Life Technologies | Cat #A1014201 | |||||||||||
| recombinant human fibroblast growth factor-2 | PeproTech | Cat #100–18B | |||||||||||
| Y-27632 ROCK Inhibitor | StemCell Technologies | Cat #07172 | |||||||||||
| Normal Horse Serum Blocking Solution | Vector Laboratories | Cat #S-2000 | |||||||||||
| ProLong Gold Antifade Mountant | Life Technologies | Cat #P36930 | |||||||||||
| Fisher Healthcare Tissue-Plus O.C.T. Compound | FisherScientific | Cat #23–730-571 | |||||||||||
| Mitomycin C | Sigma | Cat #M4287–2MG | |||||||||||
| HyClone FetalClone II Serum | ThermoScientific | Cat #SH30066.03 | |||||||||||
| Insulin | Sigma | Cat #I5500–100MG | |||||||||||
| Hydrocortisone 21-hemisuccinate sodium salt | Sigma | Cat #H2270 | |||||||||||
| Cholera Toxin | Calbiochem | Cat #227035 | |||||||||||
| 3,3’,5-Triiodo-L-Thyronine Sodium Salt | Sigma | Cat #T2752–100MG | |||||||||||
| Adenine Hydrochloride | Sigma | Cat #A9795–1g | |||||||||||
| Human Recombinant Epidermal Growth Factor | Sigma | Cat #E9644 | |||||||||||
| Critical Commercial Assays | |||||||||||||
| TruSeq Stranded mRNA Library Prep kit | Illumina | Cat #20020594 | |||||||||||
| Ribo-Zero Gold rRNA Removal kit | Illumina | Cat #MRZG12324 | |||||||||||
| NEBNext ChIP-Seq Library Prep kit | NEB | Cat #E6240S/L | |||||||||||
| Nextera DNA Library Prep Kit | Illumina | Cat #FC-121–1030 | |||||||||||
| Lipofectamine LTX Reagent with PLUS Reagent | ThermoFisher Scientific | Cat #15338100 | |||||||||||
| Lipofectamine RNAiMAX Reagent | ThermoFisher Scientific | Cat #13778075 | |||||||||||
| In-Fusion HD Cloning Kit | Clontech | Cat #639650 | |||||||||||
| One-Step RT-PCR SYBR green kit | Stratagene | Cat #600826 | |||||||||||
| RNeasy mini kit | QIAGEN | Cat #74106 | |||||||||||
| QIAquick PCR purification Kit | QIAGEN | Cat #28106 | |||||||||||
| protein-G Dynal magnetic beads | Life Technologies | Cat #10004D | |||||||||||
| Fixation/Permeabilization Solution Kit | BD | Cat #554714 | |||||||||||
| Live/dead Fixable Aqua Dead cell stain kit | ThermoFisher Scientific | Cat #L34966 | |||||||||||
| Deposited Data | |||||||||||||
| Deep sequencing data | This study | GEO: GSE108248 | |||||||||||
| Experimental Models: Cell Lines | |||||||||||||
| H9 (WA09) hESC line | Stanford Stem Cell Bank | NIHhESC-10–0062 | |||||||||||
| HUES6 hESC line | HSCI iPS Core | NIHhESC-09–0019 | |||||||||||
| iPSC | invitrogen | Macarthur et al., 2012 | |||||||||||
| CF1 Mouse Embryonic Fibroblast | Millipore | PMEF-CFL | |||||||||||
| Oligonucleotides | |||||||||||||
| Real time qRT-PCR primers are listed in Table S4. | This study | N/A | |||||||||||
| Oligonucleotides for sgRNA for CRISPR-Cas9 | This study | N/A | |||||||||||
| TFAP2C-KO gRNA1 | This study | ATGCTTAAATGCCTCGTTAC | |||||||||||
| TFAP2C-KO gRNA2 | This study | ACAGAACCTCCACGGGGACT | |||||||||||
| p63-KO gRNA1 | This study | TAGTCATTTGATTCGAGTAG | |||||||||||
| p63-KO gRNA2 | This study | GTAAAGCTGTAGTACATGCC | |||||||||||
| Oligonucleotides for siRNA | This study | N/A | |||||||||||
| TFAP2C siRNA #1: sense (50−30) | This Study | GUAAACCAGUGGCAGAAUA[dT][dT] | |||||||||||
| TFAP2C siRNA #1: antisense (50−30) | This Study | UAUUCUGCCACUGGUUUAC[dT][dT][Cyanine5] | |||||||||||
| TFAP2C siRNA #2: sense (50−30): | This Study | CACAGAACUUCUCAGCCAA[dT][dT]; | |||||||||||
| TFAP2C siRNA #2: antisense (50−30): | This Study | UUGGCUGAGAAGUUCUGUG[dT][dT][Cyanine5] | |||||||||||
| siRNA Fluorescent Universal Negative Control #1, Cyanine 5 | Sigma | Cat #SIC005–10NMOL | |||||||||||
| Oligonucleotides for shRNA | This study | N/A | |||||||||||
| KLF4 shRNA#1 (50−30) | This Study | TGAGGCAGCCACCTGGCGAGTCTGACATG | |||||||||||
| KLF4 shRNA#2 (50−30) | This Study | tcagatgaactgaccaggcactaccgtaa | |||||||||||
| Scrambled negative control non-effective shRNA | Origene | Cat #TR30021 | |||||||||||
| Recombinant DNA | |||||||||||||
| PiggyBac Doxycycline inducible plasmid (PB/TW/CRB) | courtesy of Yamanaka lab | N/A | |||||||||||
| Transposase expression plasmid | System Biosciences | Cat #PB210PA-1 | |||||||||||
| Human TFAP2C cDNA | Sino Biological Inc. | Cat #HG13115-G | |||||||||||
| PB-CRB-TFAP2C | This Study | N/A | |||||||||||
| PB-CRB-GATA3 | This Study | N/A | |||||||||||
| PB-CRB-GRHL2 | This Study | N/A | |||||||||||
| PB-CRB-KLF4 | This Study | N/A | |||||||||||
| Transposase expression plasmid | System Biosciences | Cat #PB210PA-1 | |||||||||||
| hCas9 expression plasmid | Addgene | Cat #41815 | |||||||||||
| KLF4 Human shRNA Plasmid Kit | Origene | Cat #TL316853 | |||||||||||
| Non-effective 29-mer Scrambled shRNA Cassette in pGFP-C-shLenti Vector | Origene | Cat #TR30021 | |||||||||||
| Software and Algorithms | |||||||||||||
| Tophat 2.1.0 | Kim et al., 2013 | https://ccb.jhu.edu/software/tophat/index.shtml | |||||||||||
| Cufflinks 2.2.1 | Trapnell et al., 2010 | https://github.com/cole-trapnell-lab/cufflinks | |||||||||||
| PIQ | Sherwood et al., 2014 | http://piq.csail.mit.edu/ | |||||||||||
| GREAT | McLean et al., 2010 | http://great.stanford.edu/public/html/ | |||||||||||
| EdgeR | Robinson et al., 2010 | https://bioconductor.org/packages/release/ bioc/html/edgeR.html | |||||||||||
| MACS | Zhang et al., 2008 | https://github.com/taoliu/MACS | |||||||||||
| Bowtie | Langmead et al., 2009 | http://bowtie-bio.sourceforge.net/index.shtml | |||||||||||
| StepMiner | Sahoo et al., 2007 | http://genedesk.ucsd.edu/home/public/StepMiner/ | |||||||||||
| Other | |||||||||||||
| OCT4 ChIP-seq | ENCODE | GEO: GSM803438 | |||||||||||
| p63 ChIP-seq | Zarnegar et al., 2012 | GEO: GSE33571 | |||||||||||
| NHEK Hi-C | Rao et al., 2014 | GEO: GSE63525 | |||||||||||
| DNase co-accessibility correlation across tissues | Thurman et al., 2012 | Table S7 in Thurman et al., 2012 | |||||||||||