Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of the different oligonucleotide probes for detection of H. pylori and clarithromycin resistance.
| Name | Sequence (5′-3′) | Target site | Specificity |
|---|---|---|---|
| Hpy-1 | CACACCTGACTGACTATCCCG | 16S rRNA | H. pylori |
| ClaR1 | CGGGGTCTTCCCGTCTT | 23S rRNA | A2143G (ClaR) |
| ClaR2 | CGGGGTCTCTCCGTCTT | 23S rRNA | A2144G (ClaR) |
| ClaR3 | CGGGGTCTTGCCGTCTT | 23S rRNA | A2143C (ClaR) |
| ClaWT | CGGGGTCTTTCCGTCTT | 23S rRNA | Wild type (ClaS) |
