| Cell line (Homo sapiens) |
Lung fibroblast line |
Allison et al., 2017
https://doi.org/10.1083/jcb.201609033
|
GFP-SNX1-MRC5 |
MRC5 cell line stably expressing GFP-SNX1. Mycoplasma free. |
| Cell line (H. sapiens) |
Lung fibroblast line |
Other |
GFP-Rab5-MRC5 |
MRC5 cell line stably expressing GFP-Rab5 generated by retroviral transduction by G. Pearson and E. Reid, University of Cambridge. Mycoplasma free. |
| Cell line (H. sapiens) |
MRC-5 SV1 TG1 Lung fibroblast line |
ECACC |
MRC-5 SV1 TG1 cells, cat no. 85042501 |
Mycoplasma free. |
| Antibody |
Anti-human Rab5A Rabbit monoclonal |
Cell Signalling Technology |
3547S |
IF(1/200) |
| Antibody |
Anti-human sorting nexin 1 (mouse monoclonal) |
BD Biosciences |
611482 |
IF(1/200) |
| Antibody |
Alexa594-conjugated anti-mouse IgG (donkey polyclonal) |
Jackson ImmunoResearch |
715-585-150 |
IF(1/400) |
| Antibody |
A488-conjugated donkey anti-rabbit IgG |
Jackson Immunoresearch |
711-545-152 |
IF(1/400) |
| Recombinant DNA reagent |
pLXIN-GFP-Rab5C-I-NeoR |
Other |
|
Used by G. Pearson and E. Reid, University of Cambridge to generate retrovirus containing GFP-Rab5C |
| Sequence-based reagent |
Hpa1 GFP Forward |
Other |
PCR primer |
Used by G. Pearson and E. Reid, University of Cambridge to generate retrovirus containing GFP-Rab5C. TAGGGAGTTAACATGGTGAGCAAGGGCGAGGA
|
| Sequence-based reagent |
Not1 Rab5C Reverse |
Other |
PCR primer |
Used by G. Pearson and E. Reid, University of Cambridge to generate retrovirus containing GFP-Rab5C . ATCCCTGCGGCCGCTCAGTTGCTGCAGCACTGGC
|
| Chemical compound, drug |
DAPI |
Biolegend |
422801 |
IF (1 µg/mL) |
| Chemical compound, drug |
Prolong Gold |
ThermoFisher |
P36930 |
|
| Chemical compound, drug |
Lysobrite Red |
AAT Bioquest |
22645 |
(1/2500) |
| Chemical compound, drug |
Geneticin (G418) |
Sigma-Aldrich |
G1397 |
200 µg/mL to maintain GFP-Rab5-MRC5 and GFP-SNX1-MRC5 cells in culture. |
| Chemical compound, drug |
Formaldehyde solution, 37% (wt/v) |
Sigma-Aldrich |
252549 |
|
| Chemical compound, drug |
Triton X-100 |
Anatrace |
T1001 |
|
| Software, algorithm |
NNT (aitracker.net) |
Newby et al., 2018 |
AITracker |
Web-based automated tracking service |
| Software, algorithm |
Metamorph |
Molecular Devices LLC |
Metamorph |
Metamorph Microscopy Automation and Image Analysis Software |
| Software, algorithm |
FIJI |
Schindelin, J.; Arganda-Carreras, I. and Frise, E. et al. (2012) ,‘Fiji: an open-source platform for biological-image analysis’, Nature methods 9 (7): 676–682, PMID22743772, doi:10.1038/nmeth.2019
|
FIJI/ImageJ |
|
| Software, algorithm |
DLFNN Exponent Estimator |
Han, Daniel. (2020, January 20). DLFNN Exponent Estimator (Version 0). http://doi.org/10.1101/777615
|
DLFNN/DLFNN Exponent Estimator |
Hurst exponent estimator with Deep Learning Feed-forward Neural Network application for Windows 10. Documentation included. |
| Software, algorithm |
Python3 |
Python Software Foundation.Python Language Reference 3.7. Available at www.python.org
|
Python/Python3 |
|
| Software, algorithm |
SciPy |
Virtanen et al. (2020) SciPy 1.0: Fundamental Algorithms for Scientific Computing in Python. Nature Methods, in press. |
SciPy/scipy |
|
| Software, algorithm |
Tensorflow |
Abadi et al., 2016 |
Tensorflow |
|
| Software, algorithm |
Keras |
Chollet, François and others. ‘Keras.' (2015). Available from https://keras.io
|
Keras |
|
| Software, algorithm |
fbm |
Flynn, Christopher, fbm 0.3.0 available for download at https://pypi.org/project/fbm/ or https://github.com/crflynn/fbm
|
FBM package in Python |
Exact methods for simulating fractional Brownian motion (fBm) or fractional Gaussian noise (fGn) in python. Approximate simulation of multifractional Brownian motion (mBm) or multifractional Gaussian noise (mGn). |
| Other |
35 mm glass-bottomed dishes (µ-Dish) |
Ibidi |
Cat. No. 81150 |
|
