Table 3.
Immune-related genes and primer sequences for RT-qPCR analysis of the skin mucosa in common carp.
| Name | Gene | Gene ID | Function 1 | Primer Sequences (5’→3’) | Ref. 2 |
|---|---|---|---|---|---|
| Acute-phase protein | |||||
| C-reactive protein | CRP | 109083752 | Host defense: it promotes agglutination, bacterial capsular swelling, phagocytosis, and complement fixation through its calcium-dependent binding to phosphorylcholine. | F:AGCTTTGGAAAATTCGGTTCACC R:ACTCACCCTCGTGTCACTGC |
This study |
| Antimicrobial peptides (AMP) | |||||
| Histone H2A.V-like | His2Av | 109068402 | Main role in transcription regulation, DNA repair, DNA replication, and chromosomal stability | F:CTGGTGGAGGTGTGATTCCT R:AGCGGGAACTACACGGTCTT |
This study |
| Protein-glutamine gamma-glutamyltransferase 5-like | GGGT5L | 109112827 | Key role in the gamma-glutamyl cycle and maintains normal redox status | F:AGCTGCATATCATGGACGAGTT R:CTCCGCAGAACCAGAGTGCT |
This study |
| Cytokines | |||||
| Interleukin 1 beta-like | IL1β | 109097442 | Mediator of the inflammatory response, and is involved in a variety of cellular activities, including cell proliferation, differentiation, and apoptosis | F:AAGGAGGCCAGTGGCTCTGT R:CCTGAAGAAGAGGAGGCTGTCA |
[46] |
| Interleukin 4 | IL4 | 109064937 | Participates in at least several B-cell activation processes as well as other cell types. It is a costimulator of DNA-synthesis. It induces the expression of class II MHC molecules on resting B-cells | F:TTTCTGGGCTGTCTGGTGCCAA R:TTTCTTGTCAGTACGGAAATGCTCA |
[47] |
| Interleukin 8-like | IL8 | 109085034 | Chemotactic factor that attracts neutrophils, basophils, and T-cells, but not monocytes. It is also involved in neutrophil activation. It is released from several cell types in response to an inflammatory stimulus | F:GATGCAAATGCCCTCAAATACA R:GGCTCTTGACGTTCCTTTTG |
[43] |
| Interleukin 10-like | IL10 | 109076801 | Major immune-regulatory cytokine that acts on many cells of the immune system where it has profound anti-inflammatory functions, limiting excessive tissue disruption caused by inflammation | F:CGCCAGCATAAAGAACTCGT R:TGCCAAATACTGCTCGATGT |
[46] |
| Interferon gamma | IFNγ | 109053615 | Produced by lymphocytes activated by specific antigens or mitogens | F:TGAGCTTAAAGAATGTGTGGCCCAA R:ACTCCATATGTGACGGCTTTTGGT |
[47] |
| Lectins | |||||
| C-type lectin 4 | CLEC4M | 109066444 | Binds carbohydrates mannose and fucose | F:TCAACTGGTCAGAGGCACGA R:GAAAGGCCCACTCTTCATCGTC |
This study |
| Lyzosymes | |||||
| Lyzosyme C | LyzC | 109090952 | Protection against pathogens | F:ATGAAGGTGACTATTGCTGTCTTG R:AGTAGGCCGTGCACACATAGTT |
This study |
| Lyzosyme G | LyzG | 109087581 | Protection against pathogens | F:GGCCTTCAGACGATACTTACCA R:TGGAAGCCTCGACACCCTTT |
This study |
| Mucins | |||||
| Mucin-5AC-like |
M5ACL3 (LOC109110796) |
109110796 | Forming protective mucous barriers on epithelial surfaces | F:CGATCAGTGCTATGTCCTGTCA R:ACAGTTGGGCTCACGTTTGT |
This study |
| Peroxidases | |||||
| Myeloperoxidase-like | MPO | 109052003 | Produces hypochlorous acid from hydrogen peroxide and chloride anion during the neutrophil’s respiratory burst, oxidizes tyrosine to the tyrosyl radical using hydrogen peroxide as an oxidizing agent | F:CAACCTGGTCCACAAGGTGTAGC R:GGCAGACTGTTGTCCTGTGG |
This study |
| Proteases | |||||
| Cathepsin B | CTSB | 109064698 | Bacteriolytic activity against fish pathogen | F:CACTGACTGGGGTGATAATGGATA R:GGTGCTCATTTCAGCCCTCCT |
This study |
| Cathepsin D | CTSD | 109105685 | Regulates production of parasin I | F:CGACGGCTCGCCAAAATGAG R:AGAGGAATCCGTACAATTGCGT |
This study |
| Oxidoreductase | |||||
| Thioredoxin-like |
TXNL3 (LOC109108046) |
109108046 | Cell redox homeostasis | F:GCGGGCTGCTGCTTTGACTG R:GTCGAAGGCAGGCTTATCCTCA |
This study |
| Reference genes | |||||
| Beta-actin | ACTB | 109073280 | Actins are highly conserved proteins that are involved in cell motility, structure, integrity, and intercellular signaling | F:ATCCGTAAAGACCTGTATGCCA R:GGGGAGCAATGATCTTGATCTTCA |
[24] |
| 40S ribosomal protein S11 | 40s s11 | 109061205 | Relation with viral mRNA translation and activation of the mRNA pathways upon binding of the cap-binding complex and eIFs, and subsequent binding to 43S | F:CCGTGGGTGACATCGTTACA R:TCAGGACATTGAACCTCACTGTCT |
[33] |
1 gene function derive from GeneCards (http://www.genecards.org); 2 primers marked as “this study” were designed using Primer-BLAST [45]; 3 name given for this experiment.