Table 1.

Overview of the principal miRs reported, summarizing the cellular and phenotypical effects of their upregulation or downregulation.

hsa-miR	Sequence (5′→3′)	Cellular Effect *	Phenotypical Effect	Ref.
miR-15a	UAGCAGCACAUAAUGGUUUGUG	Regulation of antiapoptotic BCL2 gene (D)	Onset of chronic lymphocytic leukemia (CLL)	[29]
miR-16	UAGCAGCACGUAAAUAUUGGCG
miR-17	CAAAGUGCUUACAGUGCAGGUAG	E2F1 expression (U)	Cell proliferation	[5]
miR-20	UAAAGUGCUUAUAGUGCAGGUAG
miR-19a	UGUGCAAAUCUAUGCAAAACUGA	upregulation of genes related to the immune response, T-cell activation, extracellular matrix and collagen network (U)	Regeneration of infarcted myocardium	[6]
miR-19b	UGUGCAAAUCCAUGCAAAACUGA
miR-21	UAGCUUAUCAGACUGAUGUUGA	Antiapoptotic action via cell growth regulation. No effects on cell proliferation (U)	Glioblastoma, breast cancer onset	[30,31]
miR-31	UGCUAUGCCAACAUAUUGCCAU	Defects in protein p53 pathways (D)	Found in ovarian cancer	[32]
miR-33	GUGCAUUGUAGUUGCAUUGCA	Upregulated expression of cholesterol efflux transporters ABCA1 in liver (D)	Increased levels of HDL in plasma	[33]
miR-138	GCUACUUCACAACACCAGGGCC	Negative regulation of osteogenic differentiation of human mesenchymal cells (U)	Bone formation reduction	[8]
miR-141	UAACACUGUCUGGUAAAGAUGG	Upregulation of Androgen receptor transcriptional activity (U)	Prostate cancer onset	[34]
miR-375	UUUGUUCGUUCGGCUCGCGUGA
miR-145	GUCCAGUUUUCCCAGGAAUCCCU	ARF6 overexpression (D)	Triple negative breast cancer onset	[35]
miR-155	UUAAUGCUAAUCGUGAUAGGGGUU	MYC overexpression (U)	CLL, Burkitt’s lymphoma, lung and colon cancer onset	[36]
miR-210	CUGUGCGUGUGACAGCGGCUGA	EFNA3 (VEGF signaling and angiogenesis) downregulation (U)	Upregulated in atherosclerotic plaques	[37]
miR-221	AGCUACAUUGUCUGCUGGGUUUC	KIT downregulation (U)	Modulation of erythropoiesis (CD34+)	[38]
miR-222	AGCUACAUCUGGCUACUGGGU
let-7	miR family (miRs let-7a-2, let-7c and let-7g involved)	RAS protein upregulation (D)	lung cancer onset	[7]

* Upregulation = U; Downregulation = D.