Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-floxed | Dr. Manolis Pasparakis, Cologne, Germany | NM-f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-K270A-floxed | Mouse Genetics Core, Washington University in St.Louis | NM-KA-f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Ikbkg (Nemo)-WT-Tg-floxed | Mouse Genetics Core, Washington University in St.Louis | NM-WT-Tg f/f | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | Lyz2 (Lysozyme M)-cre | LysM-cre | C57BL/6 background | |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-flox | This Paper | NM-cKO | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-K270A-f/f | This Paper | NM-KA | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | LysM-cre-NEMO-WT-f/f | This Paper | NM-WT-Tg | C57BL/6 background |
| Strain, Strain backgroud Mus musculus | RELA (NF-ĸB)-GFP-luciferase reporter | The Jackson Laboratory | NF-ĸB reporter mice | C57BL/6 background |
| Recombinant DNA reagent | pMX- retroviral vector | Cell biolabs | Cat# RTV-010 | Retroviral vector |
| Recombinant DNA reagent | pMX-GFP | This paper | GFP version of pMX retroviral vector | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-RFP | This paper | NEMO WT with flag tag and RFP on pMX backbone-Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K270A-RFP | This paper | NEMO K270A mutant with flag tag and RFP on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-D304N | This paper | NEMO D304N mutant on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K319A | This paper | NEMO K319A mutant with Flag tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-GFP | This paper | NEMO WT with Flag tag and GFP on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-HA-ISG15 | This paper | ISG15 with HA tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-WT-ISG15-GFP | This paper | NEMO WT-ISG15 fusion construct with GFP tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | pMX-flag-NEMO-K270A-ISG15-GFP | This paper | NEMO K270A-ISG15 fusion construct with GFP tag on pMX backbone -Available in Dr. Yousef Abu-Amer’s lab | |
| Recombinant DNA reagent | PMRX-GFP-LC3-RFP retrovirus | AddGene | Cat# 84573 | LC3 wth GFP and RFP on PMRX backbone |
| Recombinant DNA reagent | Xtreme gene 9 | Roche | Cat# 6365809001 | Transfection reagent |
| Cell line (Homo-sapiens) | PLAT-E | Cell biolabs | Cat# RV-101 | For generating retroviruses |
| Commercial assay or kit | TRAP-Leukocyte kit | Millipore-Sigma | Cat# 387A-1KT | Identify osteoclasts |
| Commercial assay or kit | luciferase activity | GoldBio | Cat# I920-50 | NFkB activity assay |
| Commercial assay or kit | BCA assay | Thermo Fisher | Cat# 23227 | Quantitation of protein |
| Other | Cell lysis buffer | Cell Signaling | Cat# 9803S | Western blot reagent |
| Antibody | donkey anti-rabbit and anti-mouse | LI-COR Biosciences | Cat# 926–32213, RRID:AB_621848 | WB(1:10,000) |
| Antibody | NEMO (Rabbit polyclonal/Mouse monoclonal) |
Santa Cruz | Cat# SC-8330, RRID:AB_2124846 |
IF(1:200), WB(1:1000) |
| Antibody | LAMP-1 (Mouse monoclonal) |
Santa Cruz | Cat# SC-20011, RRID:AB_626853 |
IF(1:200) |
| Antibody | ISG15 (Mouse monoclonal) |
Santa Cruz | Cat# SC-166755, RRID:AB_2126308 | IF(1:200), WB(1:1000) |
| Antibody | phos-p65 (Rabbit polyclonal) |
Cell Signaling | Cat# 3031, RRID:AB_330559 | WB(1:1000) |
| Antibody | p65 (Rabbit polyclonal) |
Cell Signaling Technology, | Cat# 8242, RRID:AB_10859369 | WB(1:1000) |
| Antibody | LC3 (Rabbit polyclonal) |
Cell Signaling Technology, | Cat# 3868, RRID:AB_2137707 | IF(1:200), WB(1:1000) |
| Antibody | Flag (Rabbit polyclonal) |
Millipore-Sigma | Cat# F1804, RRID:AB_262044 | WB(1:1000) |
| Antibody | β-actin (Mouse monoclonal) |
Millipore-Sigma | Cat# A2228, RRID:AB_476697 | WB(1:5000) |
| Antibody | anti-B220 (Rat monoclonal) |
Thermo Fisher | Cat# 14-0452-82, RRID:AB_467254 | FACS (1 µL per test) |
| Antibody | anti-CD3e (Armenian hamster monoclonal) |
Biolegend | Cat# 100301, RRID:AB_312666 | FACS (1 µL per test) |
| Antibody | anti-Gr1 (Rat monoclonal) |
Thermo Fisher | Cat# 14-5931-82, RRID:AB_467730 | FACS (1 µL per test) |
| Antibody | anti-Ter119 (Rat monoclonal) |
BD Bioscience | Cat#550565, RRID:AB_393756 | FACS (1 µL per test) |
| Antibody | anti-Sca1 PerCP Cy5.5 (Rat monoclonal) | Thermo Fisher | Cat# 122523, RRID:AB_893621 | FACS (1 µL per test) |
| Antibody | anti-c-Kit APC eFluor 780 (Mouse monoclonal) | Thermo Fisher | Cat# 47-1171-82, RRID:AB_1272177 | FACS (1 µL per test) |
| Antibody | anti-CD34 FITC (Mouse monoclonal) | Thermo Fisher | Cat# 343503, RRID:AB_343503 |
FACS (1 µL per test) |
| Antibody | CD16/32 eFluor450 (Rat monoclonal) | Thermo Fisher | Cat# 48-0161-82, RRID:AB_1272191 | FACS (1 µL per test) |
| Antibody | colloidal gold conjugated secondary antibodies | Jackson ImmunoResearch Laboratories | Cat# 715-205-150, RRID:AB_2340822 | Electron microscopy (1:25) |
| Antibody | Alexa Fluor 568 (goat anti-mouse IgG) | Thermo Fisher | Cat# A11031, RRID:AB_144696 | IF (1:2000) |
| Antibody | Alexa Fluor 488 (goat-anti-rabbit IgG) | Thermo Fisher | Cat# A11034, RRID:AB_2576217 | IF (1:2000) |
| Commercial assay or kit | multiplex mouse cytokine kits | R and D Systems | Cat# AYR006 | Inflammation markers |
| Commercial assay or kit | multiplex mouse cytokine kits | Millipore-Sigma | Cat# MCYTMAG-70K-PX32 | Inflammation markers |
| Commercial assay or kit | RatLaps (CTX-1) EIA | Immunodiagnostic Systems | Cat# AC-06F1 | Serum cross‐linked telopeptide of type I collagen (CTX‐I)-bone resorption marker |
| Commercial assay or kit | Mouse TRAP (TRAcP 5b) kits | Immunodiagnostic Systems | Cat# SB TR-103 | osteoclast marker |
| Commercial assay or kit | PureLink RNA mini kit | Thermo Fisher | Cat# 12183025 | RNA isolation |
| Other | iTaq universal SYBR green super-mix | BioRad | Cat# 1725120 | Real-Time PCR reagent |
| Sequence-based reagent | TRAP_F | IDT | PCR primer | CGACCATTGTTAGCCACATACG |
| Sequence-based reagent | TRAP_R | IDT | PCR primer | CACATAGCCCACACCGTTCTC |
| Sequence-based reagent | CTSK_F | IDT | PCR primer | ATGTGGGTGTTCAAGTTTCTGC |
| Sequence-based reagent | CTSK_R | IDT | PCR primer | CCACAAGATTCTGGGGACTC |
| Sequence-based reagent | MMP9_F | IDT | PCR primer | ACTGGGCTTAGATCATTCCAGCGT |
| Sequence-based reagent | MMP9_R | IDT | PCR primer | ACACCCACATTTGACGTCCAGAGA |
| Sequence-based reagent | NFATC1_F | IDT | PCR primer | CCGGGACGCCCATGCAATCTGTTAGT |
| Sequence-based reagent | NFATC1_R | IDT | PCR primer | GCGGGTGCCCTGAGAAAGCTACTCTC |
| Software, algorithm | ImageJ | Imagej.nih.gov | IF image processing, count | |
| Software, algorithm | GraphPad | Graphpad prism-8 software | Statistical Analysis software | Graph preparation, statistical analysis |