Extended Data Table 1.
Cloning strategies and oligonucleotide sequences used for plasmids generated
| Plasmid | Insert (5’ to 3’) | Backbone | Cloning Methods |
|---|---|---|---|
| pXG237 | PCR mApple | Inverse PCR on pMK1163 | Gibson Assembly |
| F:cattcctcgattccagcaaagcaccgcaacatggtgtccaagggcgaagagaacaacatg | F:cgcccttggacaccatgttgcggtgctttgctggaatcgagg | ||
| R:agttattaggtccctcgacgaattcgcctaggcttacttgtacagctcgtccattccgcc | R:gacgagctgtacaagtaagcctaggcgaattcgtcgagggacc | ||
| pXG260 | PCR EGFP | Inverse PCR on pMK237 | Gibson Assembly |
| F:ccctcctccccgccctcagggtccacggccaccatggtgagcaagggcgaggagc | F:gtgtccaagggcgaagagaac | ||
| R:attaggtccctcgacgaattcgcctaggcctacttgtacagctcgtccatgc | R:catggtggccgtggaccctg | ||
| pXG286 | PCR DELE1 from human cDNA | Linearize pMK1253 by NheI and BamHI | Gibson Assembly |
| F:agtttttttcttccatttcaggtgtcgtgagctagcgaattcagcgacatgtggcgcctc | |||
| R:tcactgcggttggcgaccggtggatcccgcggccgctgccaaaacctagtcttacaacac | |||
| pXG289 | PCR eIF1A promoter-DELE1-mClover from pXG286 | Digest pMTL3 by SpeI and MluI | Ligation |
| F:tattgactagtggataaccgtattaccgccatgc | |||
| R:gaattcacgcgtttacttgtacagctcgtccatgc | |||
| pXG272 | Gene block containing HRI cDNA from IDT | Digest pMK1253 by EcoRI and XbaI | Ligation |
| pXG294 | PCR DELE1(Δ100aa) from pXG286 | Digest pXG286 with EcoRI and NotI | Ligation |
| pXG336 | PCR DELE1(Δ125aa) from pXG286 | Digest pXG286 with EcoRI and NotI | Ligation |
| F:aattcagcgacatgcgtttcttctcatctcccttgtg | |||
| R:tcactgcggttggcgaccggtggatcccgcggccgctgccaaaacctagtcttacaacac | |||
| pXG305 | PCR DELE1(Δ148aa) from pXG286 | Digest pXG286 with EcoRI and NotI | Ligation |
| F:aattcagcgacatgggcccagctcccaggcac | |||
| R:tcactgcggttggcgaccggtggatcccgcggccgctgccaaaacctagtcttacaacac | |||
| pXG334 (DELE1 Δ140-149) | None | Inverse PCR on pXG286 | Ligation |
| F:ccagctcccaggcacactg | |||
| R:cagtgaggagcatgggtgcc | |||
| pXG313 (DELE1 Δ123-139) | None | Inverse PCR on pXG286 | Ligation |
| F:cgacaacacatcctccccagc | |||
| R:actgtgccaggagcagtgttc | |||
| pXG323 (DELE1 Δ113-122) | None | Inverse PCR on pXG286 | Ligation |
| F:cccctggaccgtttcttctcat | |||
| R:aggtcctgctggcagggatg | |||
| pXG324 (DELE1 Δ103-112) | None | Inverse PCR on pXG286 | Ligation |
| F:cagcgggtagaacactgctcc | |||
| R:gatctgccttgccagctgcag | |||
| pXG325 (DELE1 Δ93-102) | None | Inverse PCR on pXG286 | Ligation |
| F:cacttccaggcatccctgcca | |||
| R:ggccagagtgccccaagatat | |||
| pXG326 (DELE1 Δ83-92) | None | Inverse PCR on pXG286 | Ligation |
| F:gtgctggccctgcagctggc | |||
| R:tagggtgttcggggagacac | |||
| pXG327 (DELE1 Δ73-82) | None | Inverse PCR on pXG286 | Ligation |
| F:tgggatgccatatcttgggg | |||
| R:ccattggaaggcatccttcc |