Skip to main content
. 2020 Mar;8(5):211. doi: 10.21037/atm.2020.01.61

Table S1. Detailed information of NFATC1 plasmids construction.

Vector information
   General: 10418bp
   ORF frame 1: 1558-2445
   EGFP: 4350-5069
   Ampicillin: 9425-10285
   HIV-1_5_LTR, trunkHIV-1_3_LTR: 835-1015
   HIV-1_5_LTR, trunkHIV-1_3_LTR: 6223-6403
   CAG_enhancer: 318-605
   Psi: 1067-1204
   RRE: 1680-1913
   cPPT: 2444-2459
   H1-F: 2479-2502
   3FALG: 3880-3957
   WPRE: 5112-5699
   pGC-E1-SEQR: 5160-5180
   cPPT: 5886-5901
   U3PPT: 5886-5907
   CMV_immearly_promoter: 239-810
   Ubiquitin Promoter: 2617-3833
   SV40 promoter: 3964-4341
   AmpR_promoter: 10327-10355
   pBR322_origin: 8651-9270
Primer locations and sequences
   Ubi-F (3756-3778): GGGTCAATATGTAATTTTCAGTG
   FLAG-R-1 (3963-3943): GCTAGCTCATTTGTCGTCATC
Carrier Atlas
Inline graphic