Table 1.
Mature microRNA sequences and assays
| microRNA | Mature sequence | Assay ID |
|---|---|---|
| hsa‐miR‐122 | UGGAGUGUGACAAUGGUGUUUG | 002245 |
| hsa‐miR‐222 | AGCUACAUCUGGCUACUGGGU | 002276 |
| cel‐miR‐39 | UCACCGGGUGUAAAUCAGCUUG | 000200 |
| cel‐miR‐54 | UACCCGUAAUCUUCAUAAUCCGAG | 001361 |
Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.