Key resources table.
| Reagent type (species) or resource | Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Antibody | Rabbit polyclonal anti-GFP | Abcam | Cat# ab290; RRID:AB_303395 | 1:10000 |
| Antibody | Mouse monoclonal anti-mCherry | Clontech Laboratories | Cat# 632543; RRID:AB_2307319 | 1:10000 |
| Antibody | Goat Anti-Rabbit IgG Antibody, IRDye 680LT Conjugated | LI-COR Biosciences | Cat# 827–11081; RRID:AB_10795015 | 1:3000 |
| Antibody | Goat Anti-Mouse IgG Antibody, IRDye 680LT Conjugated | LI-COR Biosciences | Cat# 827–11080; RRID:AB_10795014 | 1:3000 |
| Antibody | Goat Anti-Rabbit IgG Antibody, IRDye 800CW Conjugated | LI-COR Biosciences | Cat# 827–08365; RRID:AB_10796098 | 1:3000 |
| Antibody | Goat Anti-Mouse IgG Antibody, IRDye 800CW Conjugated | LI-COR Biosciences | Cat# 827–08364; RRID:AB_10793856 | 1:3000 |
| Cell line | Human embryonic kidney 239T (HEK293T) | ATCC | CRL-3216 RRID:CVCL_0063 | |
| Chemicals | PEI | PolySciences | Cat# 24765–2 | |
| Software | ImageJ | NIH | https://imagej.nih.gov/ij/; RRID:SCR_003070 | |
| Software | GraphPad Prism 8 | GraphPad | https://www.graphpad.com/scientific-software/prism/; RRID:SCR_002798 | |
| Software | Kymoreslicewide | Github | https://github.com/ekatrukha/KymoResliceWide | |
| Strain, strain background (C. elegans) | unc-33(mn407); kyIs445[des-2::mCherry::rab-3; des-2::sad-1::gfp; Podr-1::dsRed] | Cross - this paper | STR110 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtIs3[Pdes-2::myr::GFP; Punc-122::dsRed] | Cross - this paper | STR174 | |
| Strain, strain background (C. elegans) | unc-44(tm349);hrtIs3[Pdes-2::myristoyl::GFP, Punc-122::DsRed] | Cross - this paper | STR176 | |
| Strain Caenorhabditis elegans |
unc-44(hrt2) | Harterink et al., 2018 | STR237 | |
| Strain, strain background (C. elegans) | unc-44(hrt5[GFP-KI]) | Injected - this paper | STR282 | strain was generated using pha-1 co-CRISPR |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-44(hrt5[GFP-KI]) | Cross - this paper | STR292 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi26[Pdes-2::ebp-2::mKate2 LGII] | Injected - this study | STR316 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi26[Pdes-2::ebp-2::mKate2 LGII] | Injected - this paper | STR316 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi28[Pdes-2::mKate2::maph-1.1 LGIV] | Harterink et al., 2018 | STR318 | |
| Strain, strain background (C. elegans) | hrtEx127[Punc-86::ebp-2::gfp; Pmyo-2::tdTomato] | Injected - this paper | STR366 | |
| Strain, strain background (C. elegans) | unc-33(hrt7); unc-119(ed3);hrtSi28[Pdes-2::mKate2::maph-1.1 LGIV] | Injected - this paper | STR367 | hrt7 was generated using CRISPR (11 bps deletion) |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi41[Pdes-2::unc-33L::gfp LGI] | Injected - this paper | STR369 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-33(mn407); kyIs445[des-2::mCherry::rab-3; des-2::sad-1::gfp; Podr-1::dsRed]; hrtSi41[Pdes-2::unc-33L::gfp LGI] | Cross - this paper | STR386 | |
| Strain, strain background (C. elegans) | unc-44(hrt2); hrtSi41[Pdes-2::unc-33L::gfp LGI] | Cross - this paper | STR387 | |
| Strain, strain background (C. elegans) | unc-44(hrt8); unc-119(ed3); hrtSi28[Pdes-2::mKate2::maph-1.1 LGIV] | Injected - this study | STR388 | hrt8 was generated using CRISPR (11 bps insertion) |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII]; hrtSi41[Pdes-2::unc-33L::gfp LGI] | Cross - this paper | STR405 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi54[Pdes-2::unc-33M::gfp LGI] | Injected - this paper | STR425 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII] | Cross - this paper | STR431 | |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII] | Cross - this paper | STR431 | |
| Strain, strain background (C. elegans) | unc-119(ed3); unc-44(hrt5[GFP-KI]) | Cross - this paper | STR434 | |
| Strain, strain background (C. elegans) | unc-44(hrt5[GFP-KI]); hrtSi50[Pmec-4::mKate2::maph-1.1 LGIV] | Injected and Cross - this paper | STR439 | |
| Strain, strain background (C. elegans) | unc-119(ed3); wyEx4828[Pdes-2::ebp-2::gfp; Podr- 1::RFP] | Cross - this paper | STR443 | |
| Strain, strain background (C. elegans) | unc-33(mn407); kyIs445[des-2::mCherry::rab-3; des-2::sad-1::gfp; Podr-1::dsRed]; hrtSi54[Pdes-2::unc-33M::gfp LGI] | Cross - this paper | STR444 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx142[Pdes-2::unc-119::gfp; Pdes-2::ebp-2::mKate2; Pmyo-2::tdTomato] | Injected - this paper | STR448 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx143[Pdes-2::ebp-2::mKate2; Pmyo-2::tdTomato (no cb-unc-119)] | Injected - this paper | STR449 | |
| Strain, strain background (C. elegans) | unc-119(hrt13[GFP-KI]) | Injected - this paper | STR485 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-119(hrt13[GFP-KI]) | Cross - this paper | STR499 | |
| Strain, strain background (C. elegans) | unc-44(hrt2); unc-119(hrt13[GFP-KI]) | Cross - this paper | STR500 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi69[Pdes-2::gfp::unc-33S LGI] | Injected - this paper | STR512 | |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII]; hrtSi69[Pdes-2::gfp::unc-33S LGI] | Cross - this paper | STR532 | |
| Strain, strain background (C. elegans) | unc-44(hrt5[GFP-KI]); hrtSi50[Pmec-4::mKate2::maph-1.1 LGIV] | Injected and Cross - this paper | STR439 | |
| Strain, strain background (C. elegans) | unc-119(ed3); wyEx4828[Pdes-2::ebp-2::gfp; Podr- 1::RFP] | Cross - this paper | STR443 | |
| Strain, strain background (C. elegans) | unc-33(mn407); kyIs445[des-2::mCherry::rab-3; des-2::sad-1::gfp; Podr-1::dsRed]; hrtSi54[Pdes-2::unc-33M::gfp LGI] | Cross - this paper | STR444 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx142[Pdes-2::unc-119::gfp; Pdes-2::ebp-2::mKate2; Pmyo-2::tdTomato] | Injected - this paper | STR448 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx143[Pdes-2::ebp-2::mKate2; Pmyo-2::tdTomato (no cb-unc-119)] | Injected - this study | STR449 | |
| Strain, strain background (C. elegans) | unc-119(hrt13[GFP-KI]) | Injected - this paper | STR485 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-119(hrt13[GFP-KI]) | Cross - this paper | STR499 | |
| Strain, strain background (C. elegans) | unc-44(hrt2); unc-119(hrt13[GFP-KI]) | Cross - this paper | STR500 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi69[Pdes-2::gfp::unc-33S LGI] | Injected - this paper | STR512 | |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII]; hrtSi69[Pdes-2::gfp::unc-33S LGI] | Cross - this paper | STR532 | |
| Strain, strain background (C. elegans) | unc-44(hrt5[GFP-KI]); hrtSi50[Pmec-4::mKate2::maph-1.1 LGIV] | Injected and Cross - this paper | STR439 | |
| Strain, strain background (C. elegans) | unc-119(ed3); wyEx4828[Pdes-2::ebp-2::gfp; Podr- 1::RFP] | Cross - this paper | STR443 | |
| Strain, strain background (C. elegans) | unc-33(mn407); kyIs445[des-2::mCherry::rab-3; des-2::sad-1::gfp; Podr-1::dsRed]; hrtSi54[Pdes-2::unc-33M::gfp LGI] | Cross - this paper | STR444 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx142[Pdes-2::unc-119::gfp; Pdes-2::ebp-2::mKate2; Pmyo-2::tdTomato] | Injected - this paper | STR448 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx143[Pdes-2::ebp-2::mKate2; Pmyo-2::tdTomato (no cb-unc-119)] | Injected - this paper | STR449 | |
| Strain, strain background (C. elegans) | unc-119(hrt13[GFP-KI]) | Injected - this paper | STR485 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-119(hrt13[GFP-KI]) | Cross - this paper | STR499 | |
| Strain, strain background (C. elegans) | unc-44(hrt2); unc-119(hrt13[GFP-KI]) | Cross - this paper | STR500 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi69[Pdes-2::gfp::unc-33S LGI] | Injected - this study | STR512 | |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII]; hrtSi69[Pdes-2::gfp::unc-33S LGI] | Cross - this paper | STR532 | |
| Strain, strain background (C. elegans) | hrtEx161[Pdes-2::PA-GFP::tba-1; Pdes-2::mKate2; Pmyo-2::mCherry] | Injected - this paper | STR536 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx165[Pwrt-2::unc-33L::gfp] | Injected - this paper | STR544 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx166[Pwrt-2::gfp::unc-33S] | Injected - this paper | STR545 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi70[Pdes-2::unc-33LΔC::gfp LGI] | Injected - this paper | STR546 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-44(hrt2); hrtEx161[Pdes-2::PA-GFP::tba-1; Pdes-2::mKate2; Pmyo-2::mCherry] | Cross - this paper | STR548 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx167[Pwrt-2::gfp::unc-33SΔC] | Injected - this paper | STR550 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII]; hrtEx168[Pdes-2::unc-33M::gfp;Pmyo-2::mCherry] | Injected - this paper | STR552 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi73[Prab-3::unc-33M::gfp] | Injected - this paper | STR553 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi74[Prab-3::unc −33L::gfp] | Injected - this paper | STR554 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtSi26[Pdes-2::ebp-2::mKate2 LGII]; hrtSi70[Pdes-2::gfp::unc33LΔC LGI] | Cross - this paper | STR559 | |
| Strain, strain background (C. elegans) | unc-119(ed3);hrtSi75[Pdes-2::unc-33MΔC::gfp LGI] | Injected - this paper | STR561 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtEx161[Pdes-2::PA-GFP::tba-1; Pdes-2::mKate2; Pmyo-2::mCherry] | Cross - this paper | STR563 | |
| Strain, strain background (C. elegans) | unc-116(ce815[LoxP1/unc-116/sup-1/LoxP2]); heSi175[Pscm::CRE]; hrtEx161[Pdes-2::PA-GFP::tba-1; Pdes-2::mKate2; Pmyo-2::mCherry] | Cross - this paper | STR564 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-116(ce815[LoxP1/unc-116/sup-1/LoxP2]); heSi175[Pscm::CRE]; hrtEx161[Pdes-2::PA-GFP::tba-1; Pdes-2::mKate2; Pmyo-2::mCherry] | Cross - this paper | STR575 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-44(hrt5[GFPKI]); hrtSi26[Pdes-2::ebp-2::mKate2 LGII]; hrtEx173[Pdes-2::BFP-NLS::p2A::vhhGFP::unc-33S::tbb-2UTR; Pmyo-2::mCherry] | Injected - this paper | STR576 | |
| Strain, strain background (C. elegans) | hrtIs3[Pdes-2::myr-GFP; Punc-122::dsRed] | Harterink et al., 2018 | STR58 | |
| Strain, strain background (C. elegans) | unc-44(hrt2); hrtEx175[Pwrt-2::unc33LΔC::gfp; Pmyo-2::mCherry] | Injected - this paper | STR584 | |
| Strain, strain background (C. elegans) | hrtEx175[Pwrt-2::unc33LΔC::gfp; Pmyo-2::mCherry] | Cross - this paper | STR585 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi81[Pdes-2::gfp::unc33SΔC LGI] | Injected - this paper | STR588 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-44(hrt5[GFPKI]); hrtSi26[Pdes-2::ebp-2::mKate2 LGII] | Cross - this study | STR591 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-104(e1265); hrtEx161[Pdes-2::PA-GFP::tba-1;Pdes-2::mKate2;Pmyo-2::mCherry] | Cross - this paper | STR592 | |
| Strain, strain background (C. elegans) | klc-2(km11); unc-33(mn407); hrtEx161[Pdes-2::PA-GFP::tba-1;Pdes-2::mKate2;Pmyo-2::mCherry] | Cross - this paper | STR594 | |
| Strain, strain background (C. elegans) | unc-119(ed3);hrtEx178[Pdes-2::PA-gfp::tba-1::tbb-2UTR; Pdes-2::bfp; Pmyo-2::mCherry (no cb-unc-119)] | Injected - this paper | STR595 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi87[Pdes-2::mKate2::maph-1.1 (no cb-unc-119) LGIV] | Injected - this paper | STR601 | hrtSi87 was generated using CRISPR to mutate cb-unc-119 in hrtSi28 (17 bps deletion) |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtS86[Pdes-2::unc-33L::gfp (no cb-unc-119) LGI] | Injected - this paper | STR608 | gfp is inserted in unc-33 at the start of the S isoform; hrtSi86 was generated using CRISPR to mutate cb-unc-119 in hrtSi41 (2 bp deletion and 42 bp insertion) |
| Strain, strain background (C. elegans) | unc-119(ed3); unc-44(hrt5[GFPKI]; hrtEx181[Prab-3::BFP-NLS::p2A::vhhGFP::unc-33s;Pmyo-2::mCherry (no cb-unc-119)] | Injected - this paper | STR619 | |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi89[Pdes-2::ebp-2::gfp (no cb-unc-119) LGI] | Injected - this paper | STR620 | hrtSi89 was generated using CRISPR to mutate cb-unc-119 in hrtSi5 (10 bps deletion) |
| Strain, strain background (C. elegans) | unc-119; hrtSi90[Pdes-2::unc-33LdeltaC::GFP (no cb-unc-119)] | Injected - this paper | STR621 | gfp is inserted in unc-33 at the start of the S isoform; hrtSi90 was generated using CRISPR to mutate cb-unc-119 in hrtSi70 (seven bps deletion) |
| Strain, strain background (C. elegans) | unc119(ed3); hrtSi91[[Pgcy-36::ebp-2::gfp(no cb-unc-119)] | Injected - this paper | STR622 | hrtSi91 was generated using CRISPR to mutate cb-unc-119 in hrtSi4 (10pbs deletion) |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtSi92[Pdes-2::gfp::unc-33S (no cb-unc-119) LGI] | Injected - this study | STR623 | hrtSi92 was generated using CRISPR to mutate cb-unc-119 in hrtSi69 (10pbs deletion) |
| Strain, strain background (C. elegans) | unc-119(ed3); unc-44(hrt5[GFPKI]); hrtEx182[Pdes-2::BFP-NLS::p2A::vhhGFP::unc-33S;Pdes-2::ebp-2::mKate2;Pmyo-2::mCherry (no cb-unc-119)] | Injected - this paper | STR624 | |
| Strain, strain background (C. elegans) | unc-44(hrt2); hrtSi69[Pdes-2::gfp::unc-33S LGI] | Cross - this paper | STR625 | |
| Strain, strain background (C. elegans) | unc-119(ed3);hrtEx186[Pwrt2::unc-33LΔC::gfp (no cb-unc-119)] | Injected - this paper | STR634 | gfp is inserted in unc-33 at the start of the S isoform |
| Strain, strain background (C. elegans) | unc-119(ed3); hrtEx181[Prab-3::BFP-NLS::p2A::vhhGFP::unc-33s;Pmyo-2::mCherry (no cb-unc-119)] | Cross - this paper | STR635 | |
| Strain, strain background (C. elegans) | hrtSi4[Pgcy-36::ebp-2::gfp LGI] | Harterink et al., 2018 | STR66 | |
| Strain, strain background (C. elegans) | hrtSi5[Pdes-2::ebp-2::gfp LGI] | Harterink et al., 2018 | STR71 | |
| Strain, strain background (C. elegans) | unc-33(mn407); hrtIs3[Pdes-2::myristoyl::GFP, Punc-122::DsRed] | Cross - this paper | STR95 | |
| Strain, strain background (C. elegans) | kyIs445[des-2::mCherry::rab-3; des-2::sad-1::gfp; Podr-1::dsRed] | Maniar et al., 2012 | CX9797 | |
| Strain, strain background (C. elegans) | wyEx4828[Pdes-2::ebp-2::gfp; Podr- 1::RFP] | Yan et al., 2013 | TV11781 | |
| Strain, strain background (C. elegans) | unc-33(mn407); unc-116(ce815[LoxP1/unc-116/sup-1/LoxP2]); heSi175[Pscm::CRE];hrtSi5 | Cross - this paper | STR615 | |
| Strain, strain background (C. elegans) | pgIs22 [unc-70::N-TSmod]. oxIs95 [pdi-2p::unc-70 + myo-2p::GFP] | Krieg et al., 2017 | GN600 | |
| Plasmid | sgRNA targeting sequence to generate the unc-119-GFP knock-in | This paper | pMH645 | GATGCATAATTTCCCGCCGA |
| plasmid | sgRNA targeting sequence to generate the unc-44-GFP knock in hrt8 knock-out | This paper | pMH243 | GACACGTATGAATCCGCCCA |
| plasmid | sgRNA targeting sequence to generate the unc-33(hrt7) mutant | This paper | pMH416 | GATGTCGTCGGCAATGATGG |
| RNA oligos | sgRNA targeting sequence to generate mutate cb-unc-119 in mosSCI lines | IDT | unc-119 CB (RNA guide) | CCTTGTTCGGTGCTTGGTGG |