Table I.
Candidate Reference Genes and Cellular Genes Encoding RV Interaction Partners, and Viral Genes With Respective Data for Primer Sequences
| Gene (accession numbera) | Gene name (cellular function) | Primer sequence (5′–3′)b | Reference |
|---|---|---|---|
| Candidate reference genes | |||
| TBP (M55654) | TATA‐box binding protein (transcription factor) | s ttcggagagttctgggattgta | Radonic [2005] |
| as tggactgttcttcactcttggc | |||
| HPRT1 (NM_000194.1) | Hypoxanthine phospho‐ribosyl transferase 1 (salvage pathway of purines) | s tgacactggcaaaacaatgca |
Cicinnati et al. 2008 |
| as ggtccttttcaccagcaagct | |||
| PPIA (NM_021130) | Peptidyl prolyl isomerase A (protein folding) | s catctgcactgccaagactgag | Radonic [2004] |
| as tgcaatccagctaggcatg | |||
| HUEL (NM_006345) | Solute carrier family 30 (cellular replication) | s tcagacgacgaagtccccatgaag |
Leong et al. 2005 |
| as tccttacgcaattttttctctctggc | |||
| B2MG (NM_004048) | Beta‐2‐microglobulin (MHC class I molecules) | s gagtatgcctgccgtgtg |
Silver et al. 2006 |
| as aatccaaatgcggcatct | |||
| β‐actin (NM_001101.2) | β‐actin (cytosceletal protein) | s ctctcttccaaccttccttcc |
Yuan et al. 2007 |
| as cagactcgtcatactcctgctt | |||
| GAPDH (NM_002046) | Glyceraldehyde‐3‐phosphate (enzyme of glycolytic pathway) | s tgcaccaccaactgcttagc |
Vandesompele et al. 2002 |
| as ggcatggactgtggtcatgag | |||
| RPII (X74870) | RNA polymerase II (cellular transcription) | s gcaccacgtccaatgacat | Radonic [2004] |
| as gtgcggctgcttccataa | |||
| ECHS (NM_004092) | Enoyl CoA hydratase (beta‐oxidation) | s cgctgctgtcaatggctatg |
Takahashi et al. 2007 |
| as cttggcgtcctgggctgag | |||
| Genes possibly relevant for RV replication | |||
| p32 (AF238300) | Mitochondrial/cell surface protein | s aaagttgccggggaaaaa | — |
| as tcctcctcaccatcaaatgtt | |||
| p53 (NM_000546.4) | Tumor protein p53 (tumor suppressor protein) | s ccccagccaaagaagaaac | — |
| as aacatctcgaagcgctcac | |||
| RB (NM_000321.2) | Retinoblastoma 1 (tumor suppressor protein) | s cagaataatcacactgcagcagata | — |
| as cacgcgtagttgaaccttttt | |||
| p21 (NM_000389) | Cyclin‐dependent kinase inhibitor 1A (regulator of cell cycle) | s cgaagtcagttccttgtggag |
Kasahara et al. 2005 |
| as catgggttctgacggacat | |||
| PABP (NM_002568.3) | Poly(A)‐binding protein (translation) | s gcacagccacaagttacaatg | — |
| as ctcttgaggaggggcagat | |||
| SLC25A4 (NM_001151.2) | Solute carrier family 25 (mitochondrial carrier) | s tcgtagaatgatgatgcagtcc | — |
| as cttggctccttcgtcttttg | |||
| SP100 (NM_003113) | Nuclear antigen (formation of nuclear bodies) | s aaagttgagtgccaagcccaag | Mo [2007] |
| as tctaagggctcatcaacgtcagtg | |||
| Target on RV genome | |||
| RV, P150 (L78917) | Non‐structural protein P150 (replicase) | s tgaccgcgcctatgtcaacc | — |
| as gcccgtagacaaccacctcg | |||
MHC, major histocompatibility.
a
The database source is the NCBI reference sequence database (http://www.ncbi.nlm.nih.gov/RefSeq/).
b
Oligonucleotides were in sense (s) or antisense (as) orientation.