Table 1.
Primers used in directed reverse transcription and PCR reactions
| Target Site on Genome | Direction | Primer Name | Oligonucleotide Sequence | Estimated Product Sizea |
|---|---|---|---|---|
| Replicase polyprotein (amino‐proximal region of nsp3) | Forward | FCoV nsp3 A F1 | 5′‐ATCCATATGGTTCTGGCATGG‐3′ | 730–970 bp |
| Reverse | FCoV nsp3 A R2 | 5′‐TTTAGCYGTACTATAATCATTGAGCA‐3′ | ||
| Replicase polyprotein (carboxyl‐proximal region of nsp12) | Forward | FCoV nsp12 B F1 | 5′‐CCCACAATGACTCAAATGAA‐3′ | 800 bp |
| Reverse | FCoV nsp12 B R1 | 5′‐TCTGGTTCYACCCAACACTT‐3′ | ||
| Amino‐proximal region of the surface glycoproteinb | Forward | FCoV S1 F1 | 5′‐TCTGTKGCCATCAAAATCAC‐3′ | 1900 bp |
| Reverse | FCoV S1 R1 | 5′‐CATTAACATCHACCATTACATCTG‐3′ | ||
| Forward | FCoV S1 FB | 5′‐GGAAGAGAATCAGCCTCACG‐3′ | Sequencing primers | |
| Forward | FCoV S1 FC | 5′‐TTGCGCTGGTTATGCTAAGA‐3′ | ||
| Reverse | FCoV S1 RB | 5′‐CACGACCCTGTACCAATGTG‐3′ | ||
| Reverse | FCoV S1 RC | 5′‐CACCTGTCCCACAGTATGGT‐3′ | ||
| Membrane glycoproteinb | Forward | FCoV M F1 | 5′‐GCGGTTMTAAACGAAATTGA‐3′ | 1040 bp |
| Reverse | FCoV M R1 | 5′‐TGAGTAATCACCRGCTTTAGATTT‐3′ |
a
Based on available feline FCoV genome sequences.
b
Sequence variability in the 5′ region of the surface and membrane glycoproteins necessitated the placement of the forward primer in the preceding highly conserved regions of the nsp16 and small envelope protein genes respectively.
This article is being made freely available through PubMed Central as part of the COVID-19 public health emergency response. It can be used for unrestricted research re-use and analysis in any form or by any means with acknowledgement of the original source, for the duration of the public health emergency.