Table 1.
Primers and probes used in the study
| HMPV – primers (MPVN‐F, 5′Biotin‐CTACAGGCAGCAAAGCAGAAG‐3′ and MPVN‐R, 5′Biotin‐CAGATTCAGGGCCCATTTCTC‐3′) and probe (MPVN‐Pb, 5′‐GTCATTGCCAGGTCATC‐3′) from conserved region of the HMPV nucleoprotein gene |
| FLU A – primers (P1,5′Biotin‐AAGGGCTTTCACCGAAGAGG‐3′; P2,5′Biotin‐CCCATTCTCATTACTGCTTC‐3′) and probe (5′‐GTCCTCATCGGAGGACTTGAATGGAATGAT‐3′) from nonstructural protein gene |
| FLU B – primers (P1,5′Biotin‐ATGGCCATCGGATCCTCAAC‐3′; P2, 5′Biotin‐TGTCAGCTATTATGGAGCTG‐3′) and probe (5′‐GTCAAGAGCACCGATTATCAC‐3′) from nonstructural protein gene |
| RSV – primers (P1, 5′Biotin‐TGTTATAGGCATATCATTGA‐3′; P2, 5′Biotin‐TTAACCAGCAAAGTGTTAGA‐3′) and probe (5′‐CCTGCATTAACACTAAATTC‐3′) from the F1 subunit of the fusion glycoprotein gene |
| PIV 1 – primers (P1, 5′Biotin‐CACATCCTTGAGTGATTAAGTTTGATGA‐3′; P2, 5′Biotin‐ATTTCTGGAGATGTCCCGTAGGAGAAC‐3′) and probe (5′‐TACCTTCATTATCAATTGGTAAGTCAATATATG‐3′) from the hemagglutinin‐neuraminidase gene |
| PIV 2 –primers (P1, 5′Biotin‐AACAATCTGCTGCAGCATTT‐3′; P2, 5′Biotin‐GCCCTGTTGTATTTGGAAGAGA‐3′) and probe (5′‐CCATTTACCTAAGTGATGGAAT‐3′) from the hemagglutinin‐neuraminidase gene |
| PIV 3 – primers (P1, 5′Biotin‐TAGCAGTATTGAAGTTGGCA‐3′; P2, 5′Biotin‐AGAGGTCAATACCAACAACTA‐3′) and probe (5′‐AAAATTCCAAAAGAGACCGGC‐3′) from the 5′ non‐coding region of the fusion protein gene |
| HRV‐primers (P1, 5′Biotin‐GCACTTCTGTTTCCCC‐3′; P2, 5′Biotin‐CGGACACCCAAAGTAG‐3′) and probe (5′‐GCATTCAGGGGCCGGAG‐3′) from the 5′non‐coding region |
HMPV, human metapneumovirus; FLU, influenza; RSV, respiratory syncytial virus; PIV, parainfluenza virus; HRV, human rhinovirus.