Table 1.

Characteristics of CLSs detected in lentiviral genomes

Seq. names	Nucleotidic sequences	Mersa	Max. trans.b	Viral genomesc
MMy 1	tggcgcccgaacagggac	18	3;17%	all HIV-1s, HIV-2s, AGMs, CPZs, mac., sooty, mnd., equ., fel.
MMy 3	taaaacatttagtatgggca	20	3;15%	all HIV-2s, AGMs, mac., CPZs and 152/155 HIV-1s, 9/10 sooty, 1/2 mnd.
MMy $4^{\prime }$	catcaagcagctatgcaaat	20	3;15%	all HIV-2s, mac., sooty and 146/155 HIV-1s, 1/9 AGM, 2/3 CPZs
MMy 28	agggctgttggaaatgtgg	19	3;16%	all HIV-2s and 154/155 HIV-1s, 7/8 mac., 8/10 sooty, 1/3 CPZ
MMy 31	catgggtaccagcacacaaagg	22	4;18%	all HIV-2s, AGMs, CPZs, mac., sooty, mnd., equ., Sykes' monkey and 154/155 HIV-1s, 2/3 ov.
MMy 32	tggaaaggggaaggagcagt	20	3–4;15–20%	all HIV-1s, HIV-2s, AGMs, mac., sooty, CPZs, Sykes' monkeys, mnd., cap., ov.
CLS 1	atagaagcagaagttat	17	3;18%	all HIV-1s, HIV-2s, AGMs, CPZs, mac., sooty, mnd. and 1/2 cap., 3/9 fel., 2/3 ov.
CLS 2	tttttaaaagaaaagggg	18	3;17%	all CPZs, mnd., sooty, equ., Sykes' monkey and 153/155 HIV-1s, 15/16 HIV-2s, 8/9 AGMs, 7/8 mac.
CLS 3	tagatacaggagctgatg	18	3;17%	all AGMs, CPZs, Sykes' monkey, bov., equ. and 153/155 HIV-1s, 14/16 HIV-2s, 7/8 mac., 9/10 sooty, 1/2 mnd., 7/9 fel., 2/6 ov./cap.
CLS 4	acaaggaccaaaggaacc	18	3–4;17–22%	all HIV-1s, HIV-2s, mac., sooty, mnd., equ. and 7/9 AGMs, 1/3 CPZ, 1/2 bov., 1/2 cap., 6/9 fel., 3/6 ov./cap./
CLS 5	catgggtaaaagtagtaga	19	3;16%	all CPZs, ov./cap. and 154/155 HIV-1s, 15/16 HIV-2s, 4/9 AGMs, 3/8 mac., 4/10 sooty, 1/2 mnd., 1/2 cap., 2/3 ov.
CLS 6	aaattttcgggtctattacagagaaggcagagatc	35	6;17%	all HIV-2s, AGMs, CPZs, mac., sooty, mnd. and 152/155 HIV-1s
CLS 7	gctacttccctgattg	16	3;19%	all HIV-1s and 2/3 CPZs
CLS 8	ccacctggattcctga	16	2–3;12–19%	all HIV-1s, CPZs and 1/10 sooty
CLS 9	agtactaaatggagaaaa	18	2–3;11–17%	all CPZs and 152/155 HIV-1s
CLS 10	aaaaataaccacagaaagc	19	4;22%	all CPZs, cap. and 141/155 HIV-1s, 1/16 HIV-2, 1/2 mnd., 1/10 sooty
CLS 11	caggggaaagaatagtaga	19	3;16%	all CPZs, mnd., ov./cap. and 153/155 HIV-1s, 2/3 ov.
CLS 12	acaaaaaacatcagaaagaacc	22	3;14%	153/155 HIV-1s, 1/3 CPZ, 1/2 mnd.
CLS 13	aataaaacaaattataaacatg	22	4;18%	143/155 HIV-1s, 1/2 cap.
CLS 14	acaaaagtaagaaaaaagcacagcaagc	28	1–7;4–25%	125/155 HIV-1s
CLS 15	aaactaaagaattacaaaaacaaattacaaaaatt	35	6;17%	134/155 HIV-1s, 1/3 CPZ
CLS 16	attttaaaagaaggggag	18	3;17%	all Sykes' monkey, mnd. and 144/155 HIV-1s, 12/16 HIV-2s, 1/3 CPZ, 5/8 mac., 4/10 sooty, 1/9 AGM, 1/9 fel.
CLS 17	tccatatccacaaggacc	18	3;17%	15/16 HIV-2s, 5/8 mac., 3/10 sooty, 1/9 AGM, 1/2 cap., 1/155 HIV-1
CLS 18	agtaccaacagggtcaga	18	3;17%	all HIV-2s, AGMs, mac. and 8/10 sooty, 1/2 mnd., 1/9 fel.
CLS 19	agcaccacctagcgggag	18	3;17%	all mac. and 14/16 HIV-2s, 8/10 sooty
CLS 20	agcaacagctgttggacg	18	3;17%	all HIV-2s, mac., sooty and 1/9 fel.
CLS 21	cctcctcctcctccccctccagg	23	3;13%	all mac., sooty and 15/16 HIV-2s
CLS 22	tgaaaaacctcaatgccc	18	3;17%	all AGMs, Sykes' monkey and 1/2 mnd

Abbreviations: CPZ, chimpanzee; AGM, African green monkey; mac., macaque; sooty, sooty mangabey; mnd, mandrill; bov., bovine; fel., feline; equ., equine; cap., caprine; ov., ovine; ov./cap., ovine/caprine.

^aMer-length of the sequences.

^bMaximum of admitted transitions followed by the percentage of variation they represent.

^cRatio of genomes in which the tested sequence was found for each viral family.