Table 1.
Characteristics of CLSs detected in lentiviral genomes
| Seq. names | Nucleotidic sequences | Mersa | Max. trans.b | Viral genomesc |
|---|---|---|---|---|
| MMy 1 | tggcgcccgaacagggac | 18 | 3;17% | all HIV-1s, HIV-2s, AGMs, CPZs, mac., sooty, mnd., equ., fel. |
| MMy 3 | taaaacatttagtatgggca | 20 | 3;15% | all HIV-2s, AGMs, mac., CPZs and 152/155 HIV-1s, 9/10 sooty, 1/2 mnd. |
| MMy | catcaagcagctatgcaaat | 20 | 3;15% | all HIV-2s, mac., sooty and 146/155 HIV-1s, 1/9 AGM, 2/3 CPZs |
| MMy 28 | agggctgttggaaatgtgg | 19 | 3;16% | all HIV-2s and 154/155 HIV-1s, 7/8 mac., 8/10 sooty, 1/3 CPZ |
| MMy 31 | catgggtaccagcacacaaagg | 22 | 4;18% | all HIV-2s, AGMs, CPZs, mac., sooty, mnd., equ., Sykes' monkey and 154/155 HIV-1s, 2/3 ov. |
| MMy 32 | tggaaaggggaaggagcagt | 20 | 3–4;15–20% | all HIV-1s, HIV-2s, AGMs, mac., sooty, CPZs, Sykes' monkeys, mnd., cap., ov. |
| CLS 1 | atagaagcagaagttat | 17 | 3;18% | all HIV-1s, HIV-2s, AGMs, CPZs, mac., sooty, mnd. and 1/2 cap., 3/9 fel., 2/3 ov. |
| CLS 2 | tttttaaaagaaaagggg | 18 | 3;17% | all CPZs, mnd., sooty, equ., Sykes' monkey and 153/155 HIV-1s, 15/16 HIV-2s, 8/9 AGMs, 7/8 mac. |
| CLS 3 | tagatacaggagctgatg | 18 | 3;17% | all AGMs, CPZs, Sykes' monkey, bov., equ. and 153/155 HIV-1s, 14/16 HIV-2s, 7/8 mac., 9/10 sooty, 1/2 mnd., 7/9 fel., 2/6 ov./cap. |
| CLS 4 | acaaggaccaaaggaacc | 18 | 3–4;17–22% | all HIV-1s, HIV-2s, mac., sooty, mnd., equ. and 7/9 AGMs, 1/3 CPZ, 1/2 bov., 1/2 cap., 6/9 fel., 3/6 ov./cap./ |
| CLS 5 | catgggtaaaagtagtaga | 19 | 3;16% | all CPZs, ov./cap. and 154/155 HIV-1s, 15/16 HIV-2s, 4/9 AGMs, 3/8 mac., 4/10 sooty, 1/2 mnd., 1/2 cap., 2/3 ov. |
| CLS 6 | aaattttcgggtctattacagagaaggcagagatc | 35 | 6;17% | all HIV-2s, AGMs, CPZs, mac., sooty, mnd. and 152/155 HIV-1s |
| CLS 7 | gctacttccctgattg | 16 | 3;19% | all HIV-1s and 2/3 CPZs |
| CLS 8 | ccacctggattcctga | 16 | 2–3;12–19% | all HIV-1s, CPZs and 1/10 sooty |
| CLS 9 | agtactaaatggagaaaa | 18 | 2–3;11–17% | all CPZs and 152/155 HIV-1s |
| CLS 10 | aaaaataaccacagaaagc | 19 | 4;22% | all CPZs, cap. and 141/155 HIV-1s, 1/16 HIV-2, 1/2 mnd., 1/10 sooty |
| CLS 11 | caggggaaagaatagtaga | 19 | 3;16% | all CPZs, mnd., ov./cap. and 153/155 HIV-1s, 2/3 ov. |
| CLS 12 | acaaaaaacatcagaaagaacc | 22 | 3;14% | 153/155 HIV-1s, 1/3 CPZ, 1/2 mnd. |
| CLS 13 | aataaaacaaattataaacatg | 22 | 4;18% | 143/155 HIV-1s, 1/2 cap. |
| CLS 14 | acaaaagtaagaaaaaagcacagcaagc | 28 | 1–7;4–25% | 125/155 HIV-1s |
| CLS 15 | aaactaaagaattacaaaaacaaattacaaaaatt | 35 | 6;17% | 134/155 HIV-1s, 1/3 CPZ |
| CLS 16 | attttaaaagaaggggag | 18 | 3;17% | all Sykes' monkey, mnd. and 144/155 HIV-1s, 12/16 HIV-2s, 1/3 CPZ, 5/8 mac., 4/10 sooty, 1/9 AGM, 1/9 fel. |
| CLS 17 | tccatatccacaaggacc | 18 | 3;17% | 15/16 HIV-2s, 5/8 mac., 3/10 sooty, 1/9 AGM, 1/2 cap., 1/155 HIV-1 |
| CLS 18 | agtaccaacagggtcaga | 18 | 3;17% | all HIV-2s, AGMs, mac. and 8/10 sooty, 1/2 mnd., 1/9 fel. |
| CLS 19 | agcaccacctagcgggag | 18 | 3;17% | all mac. and 14/16 HIV-2s, 8/10 sooty |
| CLS 20 | agcaacagctgttggacg | 18 | 3;17% | all HIV-2s, mac., sooty and 1/9 fel. |
| CLS 21 | cctcctcctcctccccctccagg | 23 | 3;13% | all mac., sooty and 15/16 HIV-2s |
| CLS 22 | tgaaaaacctcaatgccc | 18 | 3;17% | all AGMs, Sykes' monkey and 1/2 mnd |
Abbreviations: CPZ, chimpanzee; AGM, African green monkey; mac., macaque; sooty, sooty mangabey; mnd, mandrill; bov., bovine; fel., feline; equ., equine; cap., caprine; ov., ovine; ov./cap., ovine/caprine.
Mer-length of the sequences.
Maximum of admitted transitions followed by the percentage of variation they represent.
Ratio of genomes in which the tested sequence was found for each viral family.