Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference |
Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (virus, Ovis aries) | RVFV-35/74 | (Kortekaas et al., 2011) | RVFV-35/74 | Recombinant virus |
| Strain, strain background (virus, Homo sapiens) | RVFV-Clone 13 | (Muller et al., 1995) | RVFV-Clone 13 | Natural isolate lacking 69% of the NSs gene |
| Strain, strain background (virus, Bos taurus) | SBV NL-F6 | (Van Der Poel et al., 2014; Hulst et al., 2013) | SBV NL-F6 | Natural isolate |
| Strain, strain background (virus, Ovis aries) | SBV BH619 | (Wernike et al., 2015b) | SBV BH619 | Natural isolate |
| Strain, strain background (E. coli) | TG1 cells | Immunosource | 60502–2 | Electrocompetent cells |
| Strain, strain background (E. coli) | BL21 (DE3) | New England Biolabs | C2527H | Competent cells |
| Strain, strain background (Mus musculus) | BALB/cAnNCrl mice | Charles River Laboratories | BALB/cAnNCrl | |
| Strain, strain background (Mus musculus) | IFNAR-/-mice C57BL/6 | FLI | B6.129S2-Ifnar1tm1Agt/Mmjax | |
| Strain, strain background (yeast) | S. cerevisiae | (Harmsen and De Haard, 2007a) | S. cerevisiae | |
| Cell line Chlorocebus aethiops | Vero E6 | ATCC | CRL-1586 | |
| Cell line Spodoptera frugiperda | Sf9-ET cells | ATCC | CRL-3357 | |
| Cell line Trichoplusia ni | High Five cells | Thermo Fisher Scientific | B855-02 | |
| Recombinant DNA reagent | pRL144 | (Harmsen et al., 2005) | pRL144 | Phage display vector |
| Peptide, recombinant protein | RVFV-Gnecto | (de Boer et al., 2010) | ||
| Peptide, recombinant protein | SBV-Gchead | (Wernike et al., 2017) | ||
| Recombinant DNA reagent | Coding regions RVFV-Gn-ecto | This paper | Genscript | Table 1 |
| Recombinant DNA reagent | Coding region SBV-Gc-head | This paper | Genscript | Table 1 |
| Recombinant DNA reagent | pRL188 | (Harmsen et al., 2007b) | AJ811567 | Yeast expression vector |
| Recombinant DNA reagent | pQE-80L | Qiagen | Expression plasmid | |
| Recombinant DNA reagent | pBAC3 | Merck | 70088 | Baculo transfer plasmid |
| Commercial assay, kit | ELISA Streptactin coated microplates | IBA Lifesciences | 2-1501-001 | |
| Commercial assay, kit | FlashBac ULTRA system | Oxford Expression Technologies | 100300 | |
| Commercial assay, kit | Lightning-Link HRP Conjugation Kit | Innova Biosciences | AB102890 | |
| Other | Gravity Flow Strep-tactin Sepharose column | IBA | 2-1202-001 | |
| Other | Amicon Ultra centrifugal filters | Merck Millipore | UFC900324 | |
| Other | RVFV VLPs | (de Boer et al., 2010) | Virus-like particles | |
| Other | Ni-NTA resin | Qiagen | 30210 | |
| Other | Protein A agarose Fast Flow 50% | Sigma | P3476 | |
| Other | CHO transient expression system | (Daramola et al., 2014) | Expression system | |
| Other | Human albumin | Sigma | A9511 | |
| Other | Mouse albumin | Sigma | A3139 | |
| Other | Bovine albumin | Sigma | A7906 | |
| Other | Bis-Tris NuPAGE Novex Gels | Life Technologies | 4–12% NP0322 12% NP0342 |
|
| Other | TMB One Component HRP Microwell Substrate | SurModics | TMBW-1000–01 | |
| Other | HRP-conjugated Strep-Tactin | IBA | 2-1502-001 | 1:5000 |
| Commercial assay, kit | QIAamp Viral RNA kit | Qiagen | 52904 | |
| Commercial assay, kit | RNA Clean and Concentrator −5 kit | Zymo | R1013 | |
| Commercial assay, kit | Phusion Flash High-Fidelity PCR Master Mix | Thermo Fisher Scientific | F548 | |
| Commercial assay, kit | MagAttract Virus mini M48 kit | Qiagen | 955336 | |
| Commercial assay, kit | DNA Clean and Concentrator-5 kit | Zymo | D4014 | |
| Commercial assay, kit | Superscript III First-Strand Synthesis System | Invitrogen | 18080051 | |
| Sequence-based reagent | JR565 | This paper | PCR primers | GACAATTGATGACACATATAGCTT |
| Sequence-based reagent | JR829 | This paper | PCR primers | ACAGAGCCTCTGAGAAATGTCTG |
| Sequence-based reagent | JR830 | This paper | PCR primers | GATTTGCATACCAGTATTGGTG |
| Antibody | Polyclonal HRP-conjugated goat anti-llama IgG-H+L | Bethyl | A160-100P | IPMA (1:1000), ELISA (1:2000) |