Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Sequences of CRMP4 siRNA used in this study
| Clone Name | Symbol | Location | Length | Target Sequence |
|---|---|---|---|---|
| RSH049252-1 | CRMP4 | 281 | 19 | GGAGGCATTGATGTCCATA |
| RSH049252-2 | CRMP4 | 121 | 19 | TGACCGTCTTCTAATCAAG |
| RSH049252-3 | CRMP4 | 656 | 19 | GCCATTGCTCAAGTTCATG |
| RSH049252-4 | CRMP4 | 859 | 19 | GGCTGATCTCATCTCACAA |
| Control | 21 | TTCTCCGAACGTGTCACGTAA |
RSH049252-4-HIVU6 (OS371208) was selected as the target sequence.
