Table 1.
Sequences used in this study.
| AO Name | Sequence (5′-3′ direction) | Tm (°C) |
|---|---|---|
| NAC 9078 (20mer) | GGC CAA ACC UCG GCαT UAαC CαT | 65.2 |
| NAC 9079 (18mer) | GCC AAA CCU CGG αCUαT ACαC | 64.2 |
| NAC 9080 (18mer) | GαCC AAA αCCU αCGG CαTU AαCC | 68.8 |
| NAC 9081 (16mer) | CCA AAC CUC GGαC UαTA αC | 59.6 |
| 2′-O-MePS (20mer) | GGCCAAACCUCGGCUUACCU | 60.8 |
| 2′-O-MePS (18mer) | GCCAAACCUCGGCUUACC | 57.7 |
| 2′-O-MePS (16mer) | CCAAACCUCGGCUUAC | 53.1 |
Complementary synthetic RNA used in this study: 5′-r(AG GUA AGC CGA GGU UUG GCC)-3′. The α-l-LNA modified nucleotides are represented in red underlined letters, and U,C,A,G are 2′-O-methyl-RNA nucleotides.