Table 1.
Reference Sequence (RefSeq) mRNA | Gene Symbol | Sense and Anti-Sense Sequences | Length of the Amplicon (bp) | |
---|---|---|---|---|
NM_001243084 | HIF1A | sense | TTGGCAGCAACGACACAG | 169 bp |
anti-sense | GCAGGGTCAGCACTACTTC | |||
NM_004958 | MTOR | sense | TGCCTTCACAGATACCCAGTA | 171 bp |
anti-sense | AGACCTCACAGCCACAGA | |||
NM_000546 | P53 | sense | TCAACAAGATGTTTTGCCAACTG | 118 bp |
anti-sense | ATGTGCTGTGACTGCTTGTAGATG | |||
NM_016539 | SIRT6 | sense | CTCCTCCGCTTCCTGGTC | 119 bp |
anti-sense | TTACACTTGGCACATTCTTCC | |||
NM_002046 | GAPDH | sense | CCCTTCATTGACCTCAACTACATG | 115bp |
anti-sense | TGGGATTTCCATTGATGACAAGC |
Efficiency and specificity of primers were tested making standard curves with fivefold serial dilutions of a cDNA obtained from a pool of all samples. The first dilution was the two-fold diluted cDNA. All reactions were run in duplicate. All samples were analysed in duplicate and averaged. The relative expression of the target gene was normalized to the level of GAPDH in the same cDNA. Samples were analyzed by the 2−ΔΔCt method, as described by Livak and Schmittgen [40].