Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Nlgn1 | NCBI | NM_138666.4 | |
| Gene (Mus musculus) | Fgfr1 | NCBI | NM_010206.3 | |
| Strain, strain background (Mus musculus) | C57Bl/6J | Charles River | RRID:IMSR_JAX:000664 | |
| Genetic reagent (Mus musculus) | Nlgn1-KO | Varoqueaux et al., 2006 (PMID:16982420) | RRID:MGI:3688627 | N. Brose (MPI Goettingen) C57Bl/6J background |
| Cell line (Simian) | COS-7 | ATCC | RRID:CVCL_0224 | |
| Biological sample (Mus muscumus) | Organotypic slices (350 µm) | This paper Stoppini et al. (1991) (PMID:1715499) |
Prepared from P5-P8 animals. From C57Bl/6J WT or Nlgn1-KO mice |
|
| Transfected construct Mus musculus | HA-Nlgn1 | P. Scheiffele (Biozentrum, Basel) | In COS cells with X-TremeGENE kit | |
| Transfected construct Mus musculus | Fgfr1 V561M-FLAG (CA) | This paper | Obtained with In-Fusion HD Cloning Kit using Fgfr1-V561M-F and Fgfr1-V561M-R primers on the Fgfr1-Flag plasmid. In COS cells |
|
| Transfected construct Mus musculus | optoFgfr1-HA |
Grusch et al., 2014
(PMID:24986882) |
(RRID:Addgene_58745 | In COS cells with X-TremeGENE kit. In organotypic slices by single cell electroporation. |
| Transfected construct Mus musculus | HA-Nlgn1 Y782F |
Giannone et al., 2013
(PMID:23770246) |
In COS cells with X-TremeGENE kit. | |
| Transfected construct (Synthetic) | tdTomato | R. Tsien (UC San Diego, CA) | In organotypic slices by single cell electroporation. | |
| Transfected construct (M. musculus) | Nlgn1 -shRNA (targeting Nlgn1) |
Chih et al., 2005
(PMID:15681343) |
RRID:Addgene_59339 | Gift from P. Scheiffele In organotypic slices by single cell electroporation. |
| Transfected construct (M. musculus) | AP-Nlgn1 rescue (shRNA resistant) |
Chamma et al., 2016
(PMID:26979420) |
In organotypic slices by single cell electroporation. | |
| Transfected construct (M. musculus) | AP-Nlgn1 Y782F rescue (shRNA resistant) |
Letellier et al., 2018
(PMID:30266896) |
In organotypic slices by single cell electroporation. | |
| Transfected construct (M. musculus) | BirAER | A. Ting (Stanford University, CA) | ||
| Recombinant DNA reagent (M. musculus) | Fgfr1-Flag plasmid |
Duchesne et al., 2006
PMID:16829530 |
L. Duchesne (Université de Rennes) | |
| Sequence-based reagent | Primers Fgfr1-V561M-F; Fgfr1-V561M-R | This paper From Eurogentec |
TGTCATTATGGAGTACGCCTC;
TACTCCATAATGACATAAAGAGG |
|
| Antibody | anti-Nlgn1 (Rabbit polyclonal) | Synaptic systems 129013 | RRID:AB_2151646 | IP (2 µg) WB (1:1000) |
| Antibody | anti-phosphotyrosine P-Tyr-100 (Mouse monoclonal) | Cell Signaling Technology 9411 | RRID:AB_331228 | WB (1:1000) |
| Antibody | anti-FGFR1 (monoclonal polyclonal) | Cell Signaling Technology D8E4 9740 |
RRID:AB_11178519 | WB (1:1000) |
| Antibody | anti-HA (Rat monoclonal) |
Roche 3F10 11867423001 |
RRID:AB_390918 | WB (1:1000) IHC (1:100) |
| Antibody | Easyblot HRP antibodies anti-mouse;anti-rabbit | GeneTex GTX221667-01;GTX221666-01 |
RRID:AB_10728926; RRID:AB_10620421 | WB (1:1000) |
| Antibody | Alexa647-conjugated anti-rat antibody (Goat Polyclonal) | Molecular Probes A21247 |
RRID:AB_141778 | IHC (1:200) |
| Peptide, recombinant protein | NeutrAvidin | Invitrogen | A2666 | IHC (1:200) |
| Commercial assay or kit | In-Fusion HD Cloning Kit | Takara Bio | 639642 (Ozyme) | In COS cells |
| Commercial assay or kit | X-tremeGENE HP DNA Transfection Reagent | Roche (RRID:SCR_001326) |
6366546001 | |
| Commercial assay or kit | Dynabeads Protein G | Thermo Fisher Scientific (RRID:SCR_008452) |
10004D | For immunoprecipitation |
| Chemical compound, drug | D-AP5 | TOCRIS (RRID:SCR_003689) | 0106/10 | 50 µM |
| Chemical compound, drug | Bicuculline | TOCRIS (RRID:SCR_003689) | 0130/50 | 20 µM |
| Chemical compound, drug | NBQX | TOCRIS (RRID:SCR_003689) | 0373/10 | 100 nM or 10 µM |
| Chemical compound, drug | NHS-ester ATTO 647N | ATTO-TEC GmbH | AD 647 N-31 | |
| Software, algorithm | Metamorph | Molecular Devices | RRID:SCR_002368 | |
| Software, algorithm | GraphPad | PRISM | RRID:SCR_002798 | |
| Software, algorithm | Clampex | Axon Instruments | ||
| Software, algorithm | Clampfit | Axon Instruments | ||
| Software, algorithm | Minianalysis | Synaptosoft | RRID:SCR_002184 | |
| Software, algorithm | FluoSim |
Lagardère et al., 2020
(DOI:10.1101/2020.02.06.937045) |
Full source code will be deposited on GitHub upon paper acceptance |