Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (Mus musculus) | Cnga3 | This paper | GenBank MN381859 | Materials and methods |
| Gene (Ictidomys tridecemlineatus) | Cnga3 | This paper | GenBank MN381860 | Materials and methods |
| Strain, strain background (Mus musculus) | C57Bl/6J | The Jackson Laboratory, Bar Harbor, ME | RRID:IMSR_JAX:000664 | Materials and methods |
| Strain, strain background (Ictidomys tridecemlineatus) | Thirteen-lined Ground Squirrel | Gracheva laboratory’s colony | N/A | Materials and methods |
| Cell line (H. sapiens) | HEK293TΔPIEZO1 | Dr. Ardem Patapoutian (Scripps Research Institute) (Lukacs et al., 2015) | N/A | Materials and methods |
| Sequence-based reagent | mouse CNGA3 cloning primer forward | his paper | N/A | 5’- GAGATGGCAAAGGTGAACAC −3’ |
| Sequence-based reagent | mouse CNGA3 cloning primer reverse | this paper | N/A | 5’- GAGGCAGAGCCACCTGCATT −3’ |
| Sequence-based reagent | ground squirrel CNGA3 cloning primer forward | this paper | N/A | 5’- GGACTGAATGCAACAAGCAAG −3’ |
| Sequence-based reagent | ground squirrel CNGA3 cloning primer reverse | this paper | N/A | 5’- CCACGGAGCAGCTCATTTTC −3’ |
| Commercial assay or kit | Quick-RNA Microprep Kit | Zymo, Irvine, Ca | Cat#: R1050 | Materials and methods |
| Commercial assay or kit | SMARTer Stranded Total RNA-Seq Kit - Pico Input Mammalian | Clontech/Takara Bio, Mountain View, CA | Cat#: 635005 | Materials and methods |
| Commercial assay or kit | RNAscope Multiplex Fluorescent Reagent Kit v2 Assay | Advanced Cell Diagnostics, Hayward, CA | Cat#: 323100 | Materials and methods |
| Commercial assay or kit | RNAScope mmCnga3 probe | Advanced Cell Diagnostics, Hayward, CA | Cat#: 406131 | Materials and methods |
| Chemical compound, drug | cGMP-Na salt | Sigma | Cat#: G6129 | Materials and methods |
| Chemical compound, drug | L-cis-Diltiazem hydrochloride | Santa Cruz Biotechnology, Dallas, TX | Cat#: sc-221802 | Materials and methods |
| Software, algorithm | MetaFluor v7.8.2.0 | Molecular Devices, San Jose, CA | RRID:SCR_014294 | Materials and methods |
| Software, algorithm | ImageJ v1.51p | http://imagej.nih.gov/ij/; (Schneider et al., 2012) | RRID:SCR_003070 | Materials and methods |
| Software, algorithm |
nd Stack Builder (ImageJ plugin) | https://imagej.nih.gov/ij/plugins/track/builder.html | N/A | Materials and methods |
| Software, algorithm | Trimmomatic v0.36 | (Bolger et al., 2014) | RRID:SCR_011848 | Materials and methods |
| Software, algorithm | STAR v2.5.4b | (Dobin et al., 2013) | RRID:SCR_015899 | Materials and methods |
| Software, algorithm | featureCounts v1.6.2 | (Liao et al., 2014) | RRID:SCR_012919 | Materials and methods |
| Software, algorithm | R v3.5.1 | https://www.r-project.org | RRID:SCR_001905 | Materials and methods |
| Software, algorithm | edgeR (package for R) v3.22.3 | (Robinson et al., 2010) | RRID:SCR_012802 | Materials and methods |
| Software, algorithm | pCLAMP v10 | Molecular Devices (https://www.moleculardevices.com/) | RRID:SCR_011323 | Materials and methods |
| Software, algorithm | GraphPad Prism v8.2.0 | GraphPad Software, San Diego, CA | RRID:SCR_002798 | Materials and methods |