Table 1.
Primers and probes used for the RT-PCR assays.
| Primers and probes | Sequence (5′–3′) | Label (5′-/-3′) | Position | References |
|---|---|---|---|---|
| Influenza A matrix RT-PCR | ||||
| InfA-sense-TM | aagaccaatcctgtcacctctga | 144–166 | Ward et al.13 | |
| InfA-antisense-TM | caaagcgtctacgctgcagtcc | 217–238 | Ward et al.13 | |
| InfA-probe-2 | tttgtgttcacgctcaccgtgcc | 6-FAM/BHQ-1 | 184–206 | Munster et al.14 |
| Pandemic influenza A/H1N1-H1 and A/H1N1-N1 2009 duplex RT-PCR | ||||
| panH1-forward | ggaaagaaatgctggatctggta | 822–844 | This study | |
| panH1-reverse | atgggaggctggtgtttatagc | 904–926 | This study | |
| panH1-probe | tgcaatacaacttgtcagacacccaaggg | Dragonfly/BHQ-2 | 874–902 | This study |
| panN1-sense | acatgtgtgtgcagggataactg | 865–887 | This study | |
| panN1-antisense | tccgaaaatcccactgcatat | 949–969 | This study | |
| panN1-probe | atcgaccgtgggtgtctttcaacca | 6-FAM/BHQ-1 | 899–923 | This study |
| Pandemic influenza A/H1N1-N1 H274Y | ||||
| panN1-H275-sense | cagtcgaaatgaatgcccctaa | 797–818 | This study | |
| panN1-H275-antisense | tgcacacacatgtgatttcactag | 854–877 | This study | |
| panN1-275H-probe | ttaTCActAtgAggaatga | 6-FAM/BHQ-1 | 819–837 | This study |
| panN1-275Y-probe | ttaTTActAtgAggaatga | Dragonfly/BHQ-2 | 819–837 | This study |
a
LNA nucleotides are denoted in upper case, DNA nucleotides are denoted in lower case and LNA nucleotide complementary to the predicted single nucleotide polymorphism (SNP) is underlined.