Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Gene (M. musculus) | Acod1 | Aconitate decarboxylase 1; Irg1 | ||
| Strain, strain background (M. musculus) | C57BL/6NJ (WT) |
Jackson Laboratory | Stock No. 005304 | Male (7–11 weeks) |
| Strain, strain background (M. musculus) | C57BL/6NJ-Acod1em1(IMPC)J/J (Acod1 KO) |
Jackson Laboratory | Stock No. 029340, RRID:IMSR_JAX:029340 | Male (7–11 weeks) |
| Transfected construct (M. musculus) | Non-targeting siRNA | Dharmacon | D-001810-01-05 | |
| Transfected construct (M. musculus) | Nfe2l2 siRNA #1 | Dharmacon | J-040766-08-0002 | |
| Transfected construct (M. musculus) | Nfe2l2 siRNA #2 | Dharmacon | J-040766-06-0002 | |
| Antibody | Anti-β-actin (mouse, monoclonal) | Sigma Aldrich | Catalog #: A5441, RRID:AB_476744 | WB (1:10,000) |
| Antibody | Anti-ACOD1 (rabbit, polyclonal) | Thermo Fisher Scientific | Catalog #: PA5-49094, RRID:AB_2634550 | WB (1:500) |
| Antibody | Anti-NRF2 (rabbit, monoclonal) | Abcam | Catalog #: Ab62352, RRID:AB_944418 |
WB (1:1000) |
| Antibody | Anti-iNOS (rabbit, polyclonal) |
Cell Signaling Technology | Catalog #: 2982, RRID:AB_1078202 |
WB (1:1000) |
| Antibody | Anti-rabbit IgG, HRP-linked Antibody | Cell Signaling Technology | Catalog #: 7074, RRID:AB_2099233 | WB (1:2000) |
| Antibody | Anti-mouse IgG, HRP-linked Antibody | Cell Signaling Technology | Catalog #: 7076, RRID:AB_330924 |
WB (1:2000) |
| Sequence-based reagent | RPL13a_F | This paper | PCR Primers | GAGGTCGGGTGGAAGTACCA |
| Sequence-based reagent | RPL13a_R | This paper | PCR Primers | TGCATCTTGGCCTTTTCCTT |
| Sequence-based reagent | Acod1_F | This paper | PCR Primers | TTTGGGGTCGACCAGACTTC |
| Sequence-based reagent | Acod1_R | This paper | PCR Primers | CCATGGAGTGAACAGCAACAC |
| Sequence-based reagent | Il6_F | This paper | PCR Primers | TCCTCTCTGCAAGAGACTTCC |
| Sequence-based reagent | Il6_R | This paper | PCR Primers | AGTCTCCTCTCCGGACTTGT |
| Sequence-based reagent | Tnfa_F | This paper | PCR Primers | ATGGCCTCCCTCTCATCAGT |
| Sequence-based reagent | Tnfa_R | This paper | PCR Primers | TGGTTTGCTACGACGTGGG |
| Sequence-based reagent | Il1b_F | This paper | PCR Primers | GCCACCTTTTGACAGTGATGA |
| Sequence-based reagent | Il1b_R | This paper | PCR Primers | GACAGCCCAGGTCAAAGGTT |
| Sequence-based reagent | Nqo1_F | This paper | PCR Primers | GGTAGCGGCTCCATGTACTC |
| Sequence-based reagent | Nqo1_R | This paper | PCR Primers | CGCAGGATGCCACTCTGAAT |
| Sequence-based reagent | Gclm_F | This paper | PCR Primers | AGTTGACATGGCATGCTCCG |
| Sequence-based reagent | Gclm_R | This paper | PCR Primers | CCATCTTCAATCGGAGGCGA |
| Sequence-based reagent | Hmox1_F | This paper | PCR Primers | GAGCAGAACCAGCCTGAACT |
| Sequence-based reagent | Hmox1_R | This paper | PCR Primers | AAATCCTGGGGCATGCTGTC |
| Sequence-based reagent | Nos2_F | This paper | PCR Primers | TTCACAGCTCATCCGGTACG |
| Sequence-based reagent | Nos2_R | This paper | PCR Primers | TCGATGCACAACTGGGTGAA |
| Commercial assay or kit | Direct-zol RNA Miniprep Kits | Zymo Research | R2053 | |
| Commercial assay or kit | Mouse IL-6 DuoSet ELISA | R and D Systems | DY406 | |
| Commercial assay or kit | Mouse TNF-alpha DuoSet ELISA | R and D Systems | DY410 | |
| Commercial assay or kit | Seahorse XFe24 FluxPak | Agilent | 102340–100 | |
| Commercial assay or kit | Seahorse XF Plasma Membrane Permeabilizer | Agilent | 102504–100 | |
| Commercial assay or kit | Mouse Macrophage Nucleofector Kit | Lonza | VPA-1009 | |
| Chemical compound, drug | 4-Octyl Itaconate | Sigma Aldrich | SML2338 | |
| Chemical compound, drug | Itaconic Acid | Sigma Aldrich | I29204 | |
| Chemical compound, drug | Malonic Acid | Sigma Aldrich | M1296 | |
| Chemical compound, drug | Pyruvic Acid | Sigma Aldrich | 107360 | |
| Chemical compound, drug | Malic Acid | Sigma Aldrich | 02288 | |
| Chemical compound, drug | Succinic Acid | Sigma Aldrich | S3674 | |
| Chemical compound, drug | Particulate Matter (PM) | NIST | Urban Dust - SRM 1649a | |
| Chemical compound, drug | Lipopolysaccharide | Santa Cruz | sc-3535 | |
| Chemical compound, drug | Oligomycin | Fisher Scientific | 49-545-510MG | |
| Chemical compound, drug | FCCP | Sigma Aldrich | C2920 | |
| Chemical compound, drug | Antimycin A | Sigma Aldrich | A8674 | |
| Chemical compound, drug | Rotenone | Sigma Aldrich | R8875 | |
| Chemical compound, drug | Recombinant Mouse M-CSF | BioLegend | 576408 | |
| Software, algorithm | Prism 8 | GraphPad | RRID:SCR_002798 | |
| Software, algorithm | FastQC | Babraham Institute | RRID:SCR_014583 | |
| Software, algorithm | STAR | PMID:23104886 | RRID:SCR_015899 | |
| Software, algorithm | Picard | Broad Institute | RRID:SCR_006525 | |
| Software, algorithm | RSeQC | PMID:22743226 | RRID:SCR_005275 | |
| Software, algorithm | FeatureCounts | WEHI | RRID:SCR_012919 | |
| Software, algorithm | DESeq2 | Bioconductor | RRID:SCR_015687 |