| Antibodies |
| Anti-Digoxigenin-AP, Fab fragments |
Sigma Aldrich |
Cat# 11093274910; RRID:AB_2734716 |
| Bacterial and Virus Strains |
| Biological Samples |
|
|
| Embryos and adult digit tips from CD1 (ICR) mice, and adult digit tips from FVB/NJ mice |
This paper |
N/A |
| Chemicals, Peptides, and Recombinant Proteins |
| Trypsin |
Thermo Fisher |
Cat# 15090046 |
| Collagenase Type I |
Thermo Fisher |
Cat# 17018029 |
| ACK Lysing Buffer |
Thermo Fisher |
Cat# A1049201 |
| DIG RNA 10x labeling mix |
Sigma Aldrich |
Cat# 11277073910 |
| Proteinase K |
Sigma Aldrich |
Cat# 3115879001 |
| SP6 RNA polymerase |
Sigma Aldrich |
Cat# 10810274001 |
| T7 RNA polymerase |
Sigma Aldrich |
Cat# 10881767001 |
| Critical Commercial Assays |
| Chromium Single Cell 3′ Library Construction Kit, v2 chemistry |
10X |
N/A (No longer available) |
| Chromium Single Cell 3′ Library Construction Kit, v3 chemistry |
10X |
Cat# 1000078 |
| Hybridization chain reaction v 3.0 probe hybridization buffer, probe wash buffer, and amplification buffer |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR Probe Set: Mouse Acan (Genbank: NM_001361500.1) B3 hairpin compatible, 20 probe sets |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR Probe Set: Mouse Aldh1a2 (Genbank: NM_009022.4) B5 hairpin compatible, 20 probe sets |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR Probe Set: Mouse Mest (Genbank: NM_001252292.1) B4 hairpin compatible, 20 probe sets |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR Probe Set: Mouse Mmp13 (Genbank: NM_008607.2) B2 hairpin compatible, 20 probe sets |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR Probe Set: Mouse Scara5 (Genbank: NM_028903.2) B4 hairpin compatible, 20 probe sets |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR amplifier B2, Alexa Fluor 647 label |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR amplifier B3, Alexa Fluor 594 label |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR amplifier B4, Alexa Fluor 594 label |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR amplifier B4, Alexa Fluor 647 label |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| HCR amplifier B5, Alexa Fluor 647 label |
Molecular Instruments |
https://www.molecularinstruments.com/ |
| TrueVIEW Autofluorescence Quenching Kit |
Vector Laboratories |
Cat# SP-8400 |
| Deposited Data |
| Raw scRNA-seq data sets for adult digit tip blastemas at 11dpa, 12dpa, 14dpa, or 17dpa and the unamputated digit tip |
This paper |
GEO: GSE143888
|
| Mouse reference genome NCBI build 38, GRCm38 |
Genome Reference Consortium |
https://www.ncbi.nlm.nih.gov/genome/52 |
| Experimental Models: Cell Lines |
| Experimental Models: Organisms/Strains |
| Mouse: CD1(ICR) |
Charles River Laboratories |
Cat# 022 |
| Mouse: FVB/NJ |
The Jackson Laboratory |
Cat# JAX:001800 |
| Oligonucleotides |
| Primers for Mest cDNA amplification: 5’GCTCCAGAACCGCAGAATCA (Forward) and 5’GGGAGGTAATACAGGGAGGC (Reverse) |
Mesman et al., 2018 |
N/A |
| Recombinant DNA |
| Software and Algorithms |
| Cell Ranger (Multiple versions) |
10X Genomics |
https://support.10xgenomics.com/single-cell-gene-expression/software/pipelines/latest/installation; RRID:SCR_017344 |
| R (Version 3.5.1) |
R Core Team, 2018 |
https://www.r-project.org/; RRID:SCR_001905 |
| Seurat (Version 3.1.1) |
Stuart, Butler et al. 2018; Butler et al. 2018
|
https://satijalab.org/seurat/; RRID:SCR_016341 |
| velocyto (Version 0.17.17) |
La Manno et al. 2018 |
https://velocyto.org/ |
| scVelo (Version 0.1.20) |
Bergen et al. 2019 |
https://scvelo-notebooks.readthedocs.io/index.html |
| Doublet finder (Version 2.0) |
McGinnis et al. 2018 |
https://github.com/chris-mcginnis-ucsf/DoubletFinder |
| SPRING |
Weinreb et al. 2018 |
https://kleintools.hms.harvard.edu/tools/spring.html |
| PANTHER |
Mi et al., 2010; Thomas et al., 2003
|
http://pantherdb.org; RRID:SCR_004869 |
| Python (Version 3.7.5) |
Python Software Foundation |
https://www.python.org/; RRID:SCR_008394 |
| Zen Image Acquisition and Processing software (Multiple versions) |
Zeiss Microscope |
https://www.zeiss.com/microscopy/int/products/microscope-software/zen.html; RRID:SCR_013672 |
| Adobe Illustrator CC |
Adobe Systems |
https://www.adobe.com/products/illustrator.html; RRID:SCR_010279 |
| Adobe Photoshop CC |
Adobe Systems |
https://www.adobe.com/products/photoshop.html; RRID:SCR_014199 |
| ImageJ (Version 1.51v 9) |
NIH |
https://imagej.net/; RRID:SCR_003070 |
| Differential proportion analysis |
Farbehi et al. 2019 |
N/A |
| Other |
