Skip to main content
. 2020 Apr 30;9:e53686. doi: 10.7554/eLife.53686

Key resources table.

Reagent type
(species) or resource
Designation Source or reference Identifiers Additional information
Cell line (Homo-sapiens) ARPE19/HPV16 eGFP_CLCa This paper See Materials and methods
Cell line (Homo-sapiens) ARPE19/HPV16 eGFP_CLCa+α-AP2-WT This paper See Materials and methods
Cell line (Homo-sapiens) ARPE19/HPV16 eGFP_CLCa+α-AP2-PIP2- This paper See Materials and methods
Transfected construct (human) siRNA to EPS15 Dharmacon CONJB-000059 Sense sequence:AAACGGAGCUACAGAUUAUUU
Transfected construct (human) siRNA to EPS15R Dharmacon CONJB-000061 Sense sequence:
GCACUUGGAUCGAGAUGAGUU
Transfected construct (human) siRNA to epsin1 Dharmacon CONJB-000063 Sense sequence:
GGAAGACGCCGGAGUCAUUUU
Transfected construct (human) siRNA to SNX9 (pool of two) Dharmacon Sense sequence: #1: AAGCACUUUGACUGGUUAUU
#2:AACAGUCGUGCUAGUUCCUCA
Transfected construct (human) siRNA to FCHO1 Santa Cruz Sc-97726 transfected construct (human)
Transfected construct (human) siRNA to NECAP1 (stealth) Invitrogen HSS177973 Sense sequence: GCUCUUUGCUCAGGCACCAGUAGAA
Transfected construct (human) siRNA to NECAP2 (stealth) Invitrogen HSS148087 Sense sequence: CCGGCUGAGGAUCACUGCAAAGGGA
Transfected construct (human) siRNA to CALM Miller et al. Cell 2011 Sense sequence:ACAGTTGGCAGACAGTTTA
Transfected construct (human) siRNA to FCHO2 Santa Cruz Sc-91916 transfected construct (human)
Transfected construct (human) siRNA to ITSN1 Qiagen Sense sequence: GCAAAUGCUUGGAAGACUU
Transfected construct (human) siRNA to ITSN2 Qiagen Sense sequence: CGUAAAGCCCAGAAAGAAA
Antibody Anti-alpha Adaptin (Mouse monoclonal, AC1-M11) ThermoFisher Scientific MA3-061 WB (1:1000)
Antibody Anti-PICALM antibody [EPR12177] (Rabbit monocolonal) Abcam ab172962 WB (1:1000)
Antibody Anti-FCHO1 antibody - C-terminal (rabbit polycolonal) Abcam ab229255 WB (1:1000)
Antibody Anti-FCHO2(Rabbit polycolonal) Novus NBP2-32694 WB (1:1000)
Antibody Anti-ITSN1 (rabbit polycolonal) Sigma HPA018007 WB (1:1000)
Antibody Anti-β-Actin (Mouse monoclonal) Sigma A1978 WB (1:5000)
Antibody Anti-SNX9 (Rabbit polyclonal) Sigma HPA031410 WB (1:1000)
Antibody Anti-ITSN2 (Mouse polyclonal) Abnova H00050618-A01 WB (1:1000)
Antibody Anti-Transferrin receptor (mouse monocolonal) in-house antibody, HTR-D65, PMID:1908470 generated in-house from hybridomas, recognizes the ectodomain of the transferrin receptor
Antibody Anti-ESPS15 (Rabbit polycolonal) Santa Cruz Sc-534 WB (1:1000)
Antibody Anti-ESPS15R (Rabbit polycolonal) in-house antibody WB (1:1000)
Antibody Anti-NECAP1 (3585) (Rabbit polycolonal) Ritter et al. Biochem. Soc. Trans., 2004 WB (1:1000)
Antibody Anti-NECAP2 (3148) (Rabbit polycolonal) From Brigitte Ritter WB (1:1000)
Antibody Anti-epsin1 (goat polycolonal) Santa Cruz Sc-8673 WB (1:1000)
Software DASC (integrated to cmeAnalysis) https://github.com/DanuserLab/cmeAnalysis