Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Cell line (Homo-sapiens) | ARPE19/HPV16 eGFP_CLCa | This paper | See Materials and methods | |
| Cell line (Homo-sapiens) | ARPE19/HPV16 eGFP_CLCa+α-AP2-WT | This paper | See Materials and methods | |
| Cell line (Homo-sapiens) | ARPE19/HPV16 eGFP_CLCa+α-AP2-PIP2- | This paper | See Materials and methods | |
| Transfected construct (human) | siRNA to EPS15 | Dharmacon | CONJB-000059 | Sense sequence:AAACGGAGCUACAGAUUAUUU |
| Transfected construct (human) | siRNA to EPS15R | Dharmacon | CONJB-000061 | Sense sequence: GCACUUGGAUCGAGAUGAGUU |
| Transfected construct (human) | siRNA to epsin1 | Dharmacon | CONJB-000063 | Sense sequence: GGAAGACGCCGGAGUCAUUUU |
| Transfected construct (human) | siRNA to SNX9 (pool of two) | Dharmacon | Sense sequence: #1: AAGCACUUUGACUGGUUAUU
#2:AACAGUCGUGCUAGUUCCUCA |
|
| Transfected construct (human) | siRNA to FCHO1 | Santa Cruz | Sc-97726 | transfected construct (human) |
| Transfected construct (human) | siRNA to NECAP1 (stealth) | Invitrogen | HSS177973 | Sense sequence: GCUCUUUGCUCAGGCACCAGUAGAA |
| Transfected construct (human) | siRNA to NECAP2 (stealth) | Invitrogen | HSS148087 | Sense sequence: CCGGCUGAGGAUCACUGCAAAGGGA |
| Transfected construct (human) | siRNA to CALM | Miller et al. Cell 2011 | Sense sequence:ACAGTTGGCAGACAGTTTA | |
| Transfected construct (human) | siRNA to FCHO2 | Santa Cruz | Sc-91916 | transfected construct (human) |
| Transfected construct (human) | siRNA to ITSN1 | Qiagen | Sense sequence: GCAAAUGCUUGGAAGACUU | |
| Transfected construct (human) | siRNA to ITSN2 | Qiagen | Sense sequence: CGUAAAGCCCAGAAAGAAA | |
| Antibody | Anti-alpha Adaptin (Mouse monoclonal, AC1-M11) | ThermoFisher Scientific | MA3-061 | WB (1:1000) |
| Antibody | Anti-PICALM antibody [EPR12177] (Rabbit monocolonal) | Abcam | ab172962 | WB (1:1000) |
| Antibody | Anti-FCHO1 antibody - C-terminal (rabbit polycolonal) | Abcam | ab229255 | WB (1:1000) |
| Antibody | Anti-FCHO2(Rabbit polycolonal) | Novus | NBP2-32694 | WB (1:1000) |
| Antibody | Anti-ITSN1 (rabbit polycolonal) | Sigma | HPA018007 | WB (1:1000) |
| Antibody | Anti-β-Actin (Mouse monoclonal) | Sigma | A1978 | WB (1:5000) |
| Antibody | Anti-SNX9 (Rabbit polyclonal) | Sigma | HPA031410 | WB (1:1000) |
| Antibody | Anti-ITSN2 (Mouse polyclonal) | Abnova | H00050618-A01 | WB (1:1000) |
| Antibody | Anti-Transferrin receptor (mouse monocolonal) | in-house antibody, HTR-D65, PMID:1908470 | generated in-house from hybridomas, recognizes the ectodomain of the transferrin receptor | |
| Antibody | Anti-ESPS15 (Rabbit polycolonal) | Santa Cruz | Sc-534 | WB (1:1000) |
| Antibody | Anti-ESPS15R (Rabbit polycolonal) | in-house antibody | WB (1:1000) | |
| Antibody | Anti-NECAP1 (3585) (Rabbit polycolonal) | Ritter et al. Biochem. Soc. Trans., 2004 | WB (1:1000) | |
| Antibody | Anti-NECAP2 (3148) (Rabbit polycolonal) | From Brigitte Ritter | WB (1:1000) | |
| Antibody | Anti-epsin1 (goat polycolonal) | Santa Cruz | Sc-8673 | WB (1:1000) |
| Software | DASC (integrated to cmeAnalysis) | https://github.com/DanuserLab/cmeAnalysis |