Nrf2/ARE is a key pathway for curcumin-mediated protection of TMJ chondrocytes from oxidative stress and inflammation

Abstract

Temporomandibular joint osteoarthritis (TMJ OA) is a complex multifactorial disease that can be induced by inflammation and oxidative stress. Curcumin has been reported to have anti-inflammatory and antioxidant properties. Herein, the anti-inflammatory and antioxidant mechanisms of curcumin in TMJ OA were investigated. Curcumin treatment inhibited the expression of the inflammation mediators IL-6, iNOS, and COX-2 and of the matrix-degrading proteinases MMP-1, MMP-3, MMP-9, MMP-13, ADAMTS-4, and ADAMTS-5 and upregulated the mRNA levels of the cartilage anabolic factors COL2A1 and ACAN after IL-1β treatment. Curcumin treatment also decreased oxidative stress injury following IL-1β stimulation. Pathway analysis demonstrated that the ROS/Nrf2/HO-1-SOD2-NQO-1-GCLC signaling axis is a key axis through which curcumin activates the Nrf2/ARE pathway in TMJ inflammatory chondrocytes. Curcumin-induced anti-inflammatory and cartilage protective effects were significantly abrogated by specific Nrf2 siRNA. In vivo results demonstrated that curcumin treatment protected TMJ articular cartilage from progressive degradation. Our experimental results indicate that curcumin inhibits inflammation, oxidative stress, and the matrix degradation of TMJ inflammatory chondrocytes through the Nrf2/ARE signaling pathway, thereby exerting cartilage protective effects. This study provides insight into potential therapeutic approaches for TMJ OA.

Introduction

Temporomandibular joint osteoarthritis (TMJ OA), a prevalent disease of the TMJ, is a complex multifactorial disease affecting people of all ages (Giannakopoulos et al. 2010). Many recent studies have reported that inflammation is a key factor in the progression of TMJ OA. (Tipton et al. 2016; Zhou et al. 2018). Interleukin-1β (IL-1β), a proinflammatory cytokine, stimulates the production of a variety of inflammatory and catabolic factors and oxidative stress that cause joint damage (Haseeb and Haqqi 2013; Moskovitz et al. 2005). Cartilage destruction occurs as a result of IL-1β-induced catabolic factor overproduction, which includes the overproduction of matrix metalloproteinases (MMPs) and aggrecanase (Clutterbuck et al. 2010). Cartilage anabolites, which are the main components of the extracellular matrix of the TMJ cartilage and include collagen II and aggrecan, are degraded by catabolic enzymes MMPs and A Disintegrin and Metalloproteinase with Thrombospondin Motifs (ADAMTS) produced by oxidative stress (Altman and Gray 1985). Current therapies for TMJ OA, such as hyaluronic acid, can lubricate joints, but it is not suitable to inject hyaluronic acid during acute inflammation of the joint (da Costa et al. 2017). Therefore, new molecules and approaches to prevent and slow TMJ OA progression are urgently needed.

Oxidative stress is an important factor inducing inflammation and destruction of articular cartilage (Lepetsos and Papavassiliou 2016). Nuclear factor (erythrocyte-derived 2)-like 2 (Nrf2) is a redox-sensitive transcription factor and an important regulator in antioxidant defense systems (Motohashi and Yamamoto 2004). Nrf2 is a key regulator of antioxidants, such as HO-1, SOD, NQO-1, and GCLC, which act through the antioxidant response element (ARE) (Motohashi and Yamamoto 2004). Additionally, there is evidence that the Nrf2/ARE pathway can prevent various diseases associated with inflammation and oxidative stress (Motohashi and Yamamoto 2004). A recent report indicated that Nrf2 activation alleviates inflammation and cartilage destruction (Prasad 2016).

Curcumin (CUR), a major chemical ingredient in turmeric (Curcuma longa), exhibits significant anti-inflammatory, antioxidant, and anticancer properties (Kunnumakkara et al. 2017). Studies have shown that the anti-inflammatory effects of CUR are associated with inhibition of IL-6, iNOS, and COX-2 expression (Goel et al. 2001). Furthermore, a recent study showed that CUR inhibits the expression of matrix-degrading proteases, including MMPs and ADAMTSs (Motohashi and Yamamoto 2004). In addition, studies have shown that CUR can exert anti-inflammatory effects in several chronic diseases by activating the Nrf2 signaling pathway (Kunnumakkara et al. 2017). Therefore, we hypothesized that CUR exerts anti-inflammatory, antioxidant, and cartilage-protective effects by activating the Nrf2/ARE pathway in human TMJ inflammatory chondrocytes.

Material and methods

Reagents

Many reagents for cell culture, such as alpha minimal essential medium (α-MEM), were procured from HyClone Laboratories (Logan, UT, USA). CUR was obtained from Selleck (Shanghai, China). IL-1β and dichlorodihydrofluorescein diacetate (H₂DCF-DA) were obtained from Solarbio (Beijing, China). We obtained antibodies for GAPDH, iNOS, COX-2, MMP-1, MMP-3, MMP-9, and MMP-13 from ZENBIO (Chengdu, China). Primary antibodies against Nrf2 and p-Nrf2 were obtained from Abcam (Cambridge, UK). All the primers were obtained from TaKaRa (Otsu, Shiga, Japan).

Isolation and culture of TMJ chondrocytes

Ethics approval for the collection of human TMJ cartilage samples was obtained from the Committee of Chongqing Medical University. The collection of human TMJ cartilage samples conformed to the Declaration of Helsinki. We collected cartilage tissue from 10 patients with TMJ fractures at the Affiliated Stomatological Hospital of Chongqing Medical University. All the participants expressed informed consent. Each tissue sample was cut into 3-mm² pieces and cultured in α-MEM with 3 mg/mL collagenase I at 37 °C for 1 h. The chondrocytes were washed and resuspended in α-MEM mixed with 10% FBS and 1% antibiotics and cultivated at 37 °C with 5% CO2 (Khan et al. 2017). The medium was changed every 2 days.

Treatment with curcumin and IL-1β

TMJ chondrocytes were seeded at a density of 1 × 10⁵ cells/mL in a 6-well plate and incubated. After approximately 2–3 days of culture, to detect indicators of inflammation, chondrocytes at an approximately 80% density (2 × 10⁶ cells) were treated with CUR for 2 h and then left without further treatment or treated with IL-1β (10 ng/mL) for another 24 h (Clutterbuck et al. 2009). Cells treated with medium containing 0.1% DMSO served as a control group.

Cell viability assay

Cell Counting Kit-8 (CCK-8; Beyotime, China) was used to measure the cytotoxicity of CUR (Khan et al. 2017). When the chondrocyte density reached 5× 10⁴ cells/mL, the cells were transferred to 96-well cell culture plates and treated with CUR (0, 20, 40, 60, and 80 μM) for 0, 24, or 48 h. Then, all the medium was removed, and 100 μL α-MEM with 10% CCK-8 solution was added. The cells were then cultured at 37 °C for 2 h. Finally, the absorbance at 450 nm was measured by a microplate reader (Bio-Rad, Hercules, CA).

Reactive oxygen species measurement

For the detection of intracellular reactive oxygen species (ROS), cells (1 × 10⁵) were stained with 20 μM H₂DCF-DA at 37 °C for 30 min (Khan et al. 2011).

For the detection of ROS, TMJ chondrocytes (0.5 × 10⁵) were pretreated with CUR (40 μM) for 2 h, stimulated with or without IL-1β (10 ng/mL) for another 24 h, and then stained with H₂DCF-DA (20 μM) for 30 min. The cells were then visualized and imaged, and the ROS levels were determined using a Synergy H1 multitemplate reader (Bio-Rad, Hercules, CA) at excitation and emission wavelengths of 485 and 525 nm, respectively.

Real-time PCR

After being treated with one of the two concentrations of CUR (20, 40 μM) and IL-1β, the cells were washed three times, and lysed in RNAiso Plus (Takara, Japan). Total RNA was isolated and then reverse-transcribed to obtain cDNA (Khan et al. 2011).TaqMan Gene Expression Assays were then used to assess the mRNA levels of MMP-1, MMP-3, MMP-9, MMP-13, IL-6, iNOS, COX-2, ADAMTS-4, ADAMTS-5, COL2A1, ACAN, NQO-1, HO-1, GCLC, and SOD2 as previously described (Haseeb et al. 2013). The data were analyzed by the 2^−ΔΔCt method. The primer sequences are presented in Table 1.

Table 1.

Quantitative real-time PCR primers used in this study

Gene	Primer sequence (forward)	Primer sequence (reverse)
iNOS	ACAGGCTCGTGCAGGACTCAC	CGGCTGGATGTCGGACTTTG
COX-2	AGTCCCTGAGCATCTACGGTTTG	CTCCTGTTTAAGCACATCGCATA
IL-6	AGCCCACCGGGAACGA	GGACCGAAGGCGCTTGT
MMP-1	ACTGCCAAATGGGCTTGAAG	TTCCCTTTGAAAAACCGGACTT
MMP-3	GAGGCATCCACACCCTAGGTT	TCAGAAATGGCTGCATCGATT
MMP-9	GGGACGCAGACATCGTCATC	TCGTCATCGTCGAAATGGGC
MMP-13	ATTAAGGAGCATGGCGACTTCT	CCCAGGAGGAAAAGCATGAG
ADAMTS4	GGTCAAGGTCCCATGTGCAAC	GAATGCGGCCATCTTGTCATC
ADAMTS5	GGCCTCCATCGCCAATAGG	GGATAGCTGCATCGTAGTGCT
ACAN	GCAGACCAGGAGGTATGTGAGG	GTTGACAAACTCCTGCTCCTCG
COL2A1	GCTCCCAGAACATCACCTACCA	ACCTGCTATTGCCCTCTGCC
NQO-1	ACCCTGCGAACTTTCAGTATCC	CCTTTCAGAATGGCAGGGACT
HO-1	CTTTGAGGAGTTGCAGGAGCT	GTGTAAGGACCCATCGGAGAA
GCLC	TTGTTATGGCTTTGAGTGCTGC	TTCTTCAATGGCTCCAGTCCTC
SOD2	CTGGACAAACCTCAGCCCTAAC	GAAACCAAGCCAACCCCAAC

Western blotting

After treatment, the TMJ chondrocytes were lysed using RIPA lysis buffer to obtain total protein (Haseeb et al. 2013). A BCA kit (Beyotime) was used to measure relative protein concentrations, and 5× loading buffer was mixed with protein samples. The protein lysate was separated via SDS-PAGE and transferred onto a polyvinylidene fluoride membrane (Bio-Rad, USA). After 2 h of blocking with 5% skim milk, primary antibodies targeting GAPDH (1:500), iNOS (1:500), COX-2 (1:500), Nrf2 (1:500), p-Nrf2 (1:5000), HO-1 (1:5000), and NQO-1 (1:1000) were incubated with the membranes overnight at 4 °C. After visualization and imaging of the blots with Electrochemiluminescence Plus reagent (Invitrogen), the ImageJ software 2.1 (Bethesda, MD, USA) was used to analyze the intensities of the bands.

Immunofluorescence

After being inoculated in a 6-well chamber slide, TMJ chondrocytes (1 × 10⁶) were treated with CUR (40 μM) for 2 h and then with IL-1β (10 ng/mL) at 37 °C for 24 h. The cells were fixed with 4% paraformaldehyde and then permeabilized in 0.3% Triton X-100 at room temperature. Next, the cells were incubated with 5% goat serum at room temperature for 1 h, washed three times and incubated with Nrf2 primary antibody at 4 °C overnight. Then, the cytoplasm and nucleus were stained with Alexa Fluor 555 secondary antibody (Bioss) for 2 h and DAPI (Sigma Aldrich) for 5 min, respectively. The cells were observed and images were captured with a fluorescence microscope (EU 5888; Leica, Wetzlar, Germany).

siRNA-mediated Nrf2

The TMJ chondrocytes were transfected with 100 nM Nrf2 siRNA using Entranster™-R4000 transfection reagent (Engreen, USA) in accordance with the manufacturer’s instructions. After transfection, the cells were treated with CUR (40 μM) and IL-1β (10 ng/mL). Gene expression levels were detected via real-time PCR (Haseeb et al. 2013).

Animals

Male Sprague-Dawley rats (8 weeks old and weighing 300 g) were obtained from the Animal Center of Chongqing Medical University. All animal experiments were performed according to the terms of the Animal Committee. We divided 36 male rats into 3 groups: a degeneration group (injections of complete Freund’s adjuvant (CFA) only), an NS group (weekly injections of NS containing 0.1% DMSO), and a CUR group (weekly injections of 40 μM CUR in NS). The TMJ cavity injections were performed using a microsyringe (Lavelle et al. 2007). The in vivo dose of CUR was based on the non-toxic and effective dose defined in vitro.

Histopathological analysis

Rat TMJ samples were harvested 1 or 4 weeks after treatment. After being fixed with 4% paraformaldehyde for 24 h at 4 °C, the TMJ samples were decalcified with 10% EDTA solution. Then, after dehydration and clearing, the samples were embedded in paraffin. Subsequently, 5 μM was considered to be the best thickness for section staining. After Safranin O/fast green staining, the integrity and morphology of the cartilage were scored using criteria described by the Osteoarthritis Research Society International (OARSI) (Pritzker et al. 2006). Protein levels were observed via immunohistochemical staining.

Statistical analyses

Data are presented as mean ± S.D. GraphPad Prism 7.0 (GraphPad Software, USA) was employed to perform statistical analysis. One-way ANOVA and Tukey’s test were performed for comparisons of multiple groups. All procedures were repeated with three biological replicates to verify the results. p < 0.05 was considered statistically significant.

Results

Effect of curcumin on cell viability

The chemical structure of CUR is shown in Fig. 1a (Poulet and Beier 2016). To determine the cytotoxicity of CUR in chondrocytes, human TMJ chondrocytes were incubated with different concentrations of CUR for one of several durations, and CCK-8 assay was used to assess cell viability. Relative to the control treatment, CUR treatment (20 and 40 μM) showed no toxicity in TMJ chondrocytes (Fig. 1b). Thus, we used these concentrations (20 and 40 μM) for further study.

Fig. 1.

a–b Curcumin (CUR) inhibits the expression of IL-1β-induced inflammatory mediators in human TMJ chondrocytes. a Chemical structure of CUR. b The cytotoxic effect of CUR at various concentrations (0, 20, 40, 60, and 80 μM) in chondrocytes was determined at 0, 24, and 48 h via CCK-8 assay. The results are expressed as percent cell viability compared with the control. The values presented are the mean ± SD. ****p < 0.0001, compared with 24-h treatment; ^####p < 0.0001, compared with the control group; n = 5. c–e Human TMJ chondrocytes were pretreated with CUR (20 and 40 μM) for 2 h followed by IL-1β (10 ng/mL) for 24 h. Protein samples and RNA were harvested. c IL-6, COX-2, and iNOS mRNA expression was measured via quantitative PCR. GAPDH was used as an internal control. d–e COX-2 and iNOS protein expression and quantification determined by Western blotting. The data were analyzed using one-way ANOVA followed by post hoc analyses using Tukey’s test and are expressed as the mean ± SD. *p < 0.05, ***p < 0.001, and ****p < 0.0001, compared with the IL-1β treatment group; n = 3

Curcumin treatment inhibits the expression of inflammatory factors

Inflammation plays a key role in the development of TMJ OA (Tipton et al. 2016; Zhou et al. 2018). Hence, we examined whether CUR affects IL-1β-induced mRNA levels of iNOS, COX-2, and IL-6. TMJ chondrocytes were pretreated with CUR (20 or 40 μM) for 2 h and then provoked with IL-1β for another 24 h. The data (Fig. 1c) showed that as predicted (Haseeb et al. 2013; Yan-Qin et al. 2018), CUR treatment inhibited iNOS, COX-2, and IL-6 mRNA expression relative to the corresponding expression in cells treated only with IL-1β. In addition, Western blot analysis (Fig. 1d–e) indicated that curcumin treatment inhibited the protein levels of iNOS and COX-2. These results indicate that CUR may exert an anti-inflammatory role at the genetic and protein levels.

Curcumin protects against IL-1β-induced oxidative stress

IL-1β stimulation has been reported to affect intercellular ROS levels (Poulet and Beier 2016). Therefore, we explored the effect of CUR on IL-1β-induced oxidative stress in TMJ chondrocytes. We measured ROS levels using the 2′,7′-dichlorofluorescein (DCF) reagent, and the data revealed that IL-1β enhanced ROS level in TMJ chondrocytes, whereas ROS generation was inhibited by pretreatment with CUR (Fig. 2a–b). Our data demonstrate that CUR treatment effectively suppresses ROS production, thereby inhibiting IL-1β-induced oxidative stress.

Fig. 2.

Curcumin (CUR) inhibits IL-1β-induced oxidative stress in human TMJ chondrocytes. Human TMJ chondrocytes were treated with CUR (20 or 40 μM) for 2 h, stimulated with IL-1β (10 ng/mL) for another 24 h at 37 °C, and then stained with H₂DCF-DA (20 μM) for 0.5 h at 37 °C. a The cells were visualized and images were captured using a fluorescence microscope. b Fluorescence emission of DCF was measured at 525 nm after excitation at 485 nm. The data are expressed as the mean ± SD. **p < 0.01 and ****p < 0.0001, compared with the IL-1β treatment group; n = 4. The data were analyzed using one-way ANOVA followed by post hoc analyses using Tukey’s test

Curcumin protects cartilage from ECM degradation

Inflammation activates matrix-degrading proteases to induce ECM degradation (Goldring 2012; Lepetsos and Papavassiliou 2016). It has been reported that aggrecanases and MMPs are activated by IL-1β in human OA pathogenesis (Haseeb and Haqqi 2013; Shakibaei et al. 2007). We examined the mRNA levels of MMP-1, MMP-3, MMP-9, MMP-13, ADAMTS-4, and ADAMTS-5 in human TMJ chondrocytes under different conditions. The data demonstrated that IL-1β stimulation enhanced the mRNA levels of MMP-1, MMP-3, MMP-9, MMP-13, ADAMTS-4, and ADAMTS-5, whereas CUR treatment inhibited the mRNA levels of these proteinases (Fig. 3a). In addition, Western blotting analyses indicated that the protein levels of MMP-1, MMP-3, MMP-9, and MMP-13 were suppressed by pretreatment with CUR (Fig. 3b–c). Taken together, these results demonstrate that CUR can reduce ECM degradation in human TMJ inflammatory chondrocytes.

Fig. 3.

Curcumin (CUR) inhibits IL-1β-induced ECM degradation in human TMJ chondrocytes. Human TMJ chondrocytes were pretreated with CUR (20 or 40 μM) for 2 h followed by IL-1β (10 ng/mL) for 24 h. At the end of the treatment, chondrocytes were harvested. Protein samples were used for Western blotting, and RNA was isolated for real-time PCR analysis. a, d MMP-1, MMP-3, MMP-9, MMP-13, ADAMTS-4, ADAMTS-5, COL2A1, and ACAN mRNA expression was measured via quantitative PCR. GAPDH was used as an internal control. b–c MMP-1, MMP-3, MMP-9, and MMP-13 protein expression and quantification determined by Western blotting. The data are expressed as the mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, compared with the IL-1β treatment group; n = 3. The data were analyzed using one-way ANOVA followed by post hoc analyses using Tukey’s test

Curcumin attenuates IL-1β inhibition of COL2A1 and ACAN

We explored the effects of CUR on the mRNA levels of COL2A1 and ACAN. The results showed (Fig. 3d) that IL-1β stimulation reduced the mRNA levels of COL2A1 and ACAN in TMJ chondrocytes. Moreover, pretreatment with CUR increased the COL2A1 and ACAN mRNA levels. These data demonstrate that CUR can protect cartilage by upregulating the levels of the cartilage anabolic factors COL2A1 and ACAN under pathological conditions.

Curcumin upregulates the level of Nrf2 in human TMJ inflammatory chondrocytes

As previously reported, Nrf2 exerts anti-inflammatory effects (Ahmed et al. 2017; Shakibaei et al. 2007). To investigate the potential anti-inflammatory mechanism of CUR in human TMJ inflammatory chondrocytes, we examined the Nrf2 and p-Nrf2 levels in IL-1β-stimulated human TMJ chondrocytes pretreated with CUR. The results showed that the protein levels of Nrf2 and p-Nrf2 increased in response to CUR treatment (Fig. 4a–b). Furthermore, immunofluorescence staining showed significant Nrf2 accumulation in the nucleus after treatment with CUR for 24 h (Fig. 4c). These results indicate that CUR treatment enhances the levels of Nrf2 and p-Nrf2 in human TMJ inflammatory chondrocytes.

Fig. 4.

Curcumin (CUR) activates Nrf2 in human TMJ inflammatory chondrocytes. Human TMJ chondrocytes were pretreated with CUR (20 or 40 μM) for 2 h followed by IL-1β (10 ng/ml) for 24 h. At the end of treatment, chondrocytes were harvested. a–b Nrf2 and p-Nrf2 protein expression and quantification determined by Western blotting. c Nuclear translocation of Nrf2 in CUR-treated (40 μM) TMJ OA chondrocytes was assessed by immunofluorescence; the cells were visualized and images were captured using a fluorescence microscope. The data are expressed as the mean ± SD. ****p < 0.0001, compared with the IL-1β treatment group; n = 3. The data were analyzed using one-way ANOVA followed by post hoc analyses using Tukey’s test

Silencing of the Nrf2 gene abrogates the effects of curcumin

To explore the role of Nrf2 in the anti-inflammatory and cartilage-protective effects of CUR, we knocked down Nrf2 in TMJ chondrocytes via RNA silencing (Fig. 5a–b). Under the stimulation of IL-1β, Nrf2 silencing abolished the CUR-mediated downregulation of iNOS, COX-2, IL-6, and MMP-13 mRNA levels and the CUR-mediated upregulation of COL2A1 and ACAN mRNA levels(Fig. 5c). These findings indicate that Nrf2 is a key factor in CUR-mediated suppression of inflammation and upregulation of anabolic factors in human TMJ inflammatory chondrocytes.

Fig. 5.

Silencing of the Nrf2 gene abrogates the anti-inflammatory and chondroprotective effects of curcumin (CUR) in human TMJ inflammatory chondrocytes. TMJ chondrocytes were transfected with siRNA (100 nM) specific to Nrf2. a–b Forty-eight hours after transfection, TMJ chondrocytes were harvested to test the effect of siRNA or serum starved and treated with CUR (40 μM) for 2 h and then stimulated with IL-1β (10 ng/ml) for 24 h. Then, chondrocytes were harvested, and RNA was isolated for real-time PCR analysis. c IL-6, iNOS, COX-2, MMP-13, COL2A1, and ACAN mRNA expression was measured via quantitative PCR. The data are expressed as the mean ± SEM. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, compared with the control group; ^#p < 0.05, ^##p < 0.01, ^###p < 0.001, and ^####p < 0.0001, compared with the IL-treatment group; ^&p < 0.05, ^&&p < 0.01, ^&&&p < 0.001, and ^&&&&p < 0.0001, compared with the con-siRNA IL-1β + CUR group; n = 3. The data were analyzed using three-way ANOVA followed by post hoc analyses using Tukey’s test

Curcumin upregulates the expression of Nrf2-related antioxidants in chondrocytes

Because Nrf2 is a key factor in CUR-mediated anti-inflammatory and antioxidant processes, we next explored the potential molecular mechanism by which CUR regulates the Nrf2 pathway (Ahmed et al. 2016). We examined mRNA and protein levels of downstream antioxidant factors of Nrf2 in TMJ chondrocytes. The results indicated that pretreatment with CUR enhanced the mRNA levels of HO-1 SOD2, NQO-1, and GCLC in IL-1β-induced TMJ chondrocytes (Fig. 6a). Additionally, NQO-1 and HO-1 protein expression was enhanced by CUR treatment (Fig. 6b–c). These results suggest that CUR can activate Nrf2 and its downstream signaling pathways.

Fig. 6.

Curcumin (CUR) upregulates the expression of Nrf2-dependent genes in human TMJ inflammatory chondrocytes. Human TMJ chondrocytes were pretreated with CUR (20 or 40 μM) for 2 h followed by IL-1β (10 ng/ml) for 24 h. At the end of treatment, chondrocytes were harvested. Protein samples were used for Western blotting, and RNA was isolated for real-time PCR analysis. a SOD2, GCLC, NQO-1, and HO-1 mRNA expression was measured via quantitative PCR. GAPDH was used as an internal control. b–c NQO-1 and HO-1 protein expression and quantification determined by Western blotting. The data are expressed as the mean ± SD. *p < 0.05, **p < 0.01, ***p < 0.001, and ****p < 0.0001, compared with the IL-1β treatment group; n = 3. The data were analyzed using one-way ANOVA followed by post hoc analyses using Tukey’s test

Curcumin alleviates TMJ arthritis development in a mouse model

To investigate whether CUR protects the TMJ from inflammation in vivo, CUR was injected into the TMJs weekly after the injection of CFA (Lavelle et al. 2007; Togni et al. 2018). Macroscopic analysis of the TMJ in rat showed that tissue reactions, inflammation, swelling, hyperplasia, and angiogenesis were significantly different between CUR-treated and control TMJs (Fig. 7a). Histological changes in TMJ tissue after treatment with or without CUR were analyzed via Safranin-O staining and scored (de Souza et al. 2012; Zhang et al. 2010). The degeneration group exhibited significant cartilage erosion and notable proteoglycan loss. However, the CUR group showed smooth cartilage and reduced proteoglycan loss relative to that of the degeneration group (Fig. 7b). Next, we explored the effects of CUR on the protein levels of Nrf2, iNOS, COX-2, IL-1β, MMP-9, and MMP-13 in vivo. Immunohistochemistry analysis showed that the protein levels of iNOS, COX-2, IL-1β, MMP-9, and MMP-13 were higher in the degeneration group than in the control group, whereas the levels of these proteins were reduced in the CUR group (Fig. 7d, Fig. 8a–d). Nuclear Nrf2 expression was significantly increased in the CUR group relative to that in the other groups (Fig. 7c). Together, these results indicate that CUR protects the TMJ from inflammation in vivo.

Fig. 7.

Curcumin (CUR) exerts anti-inflammatory and chondroprotective effects in vivo. Thirty-six male rats were divided into three groups: a control group (without injection), a degeneration group (injections of CFA only), and a CUR group (weekly injections of 40 μM CUR in NS). a Representative morphological features of the TMJ disk of rats in control, CFA and CUR treatment groups. (B) Safranin O/fast green staining of TMJ tissues. c–d An immunohistochemical analysis was performed to assess the expression of Nrf2 (nuclear) and iNOS (nuclear) in TMJ samples. The data are expressed as the mean ± SD. **p < 0.01, ***p < 0.001, and ****p < 0.0001, compared with the CFA treatment group; n = 12. The data were analyzed using one-way ANOVA followed by post hoc analyses using Tukey’s test

Fig. 8.

Curcumin (CUR) exerts anti-inflammatory and chondroprotective effects in vivo. a–d. An immunohistochemical analysis was performed to assess the expression of COX-2, IL-1β, MMP-13, and MMP-9 in TMJ samples. The data are expressed as the mean ± SD. **p < 0.01, ***p < 0.001, and ****p < 0.0001, compared with the CFA treatment group; n = 12. The data were analyzed using one-way ANOVA followed by post hoc analyses using Tukey’s test

Discussion

TMJ OA is a common stomatognathic disease with a complex and multifactorial pathogenesis (Paniagua et al. 2017). The clinical features of TMJ OA are pain, dental malocclusion, and limited mouth opening (Souza et al. 2008). Previous reports have shown that inflammation, oxidative stress, and matrix degradation are important contributors to arthritis (Zhou et al. 2018). IL-1β plays an important role in the induction of TMJ inflammation and oxidative stress by stimulating a range of molecular interactions (Haseeb et al. 2013). Hence, in this study, IL-1β was used as a proinflammatory agent.

Growing evidence suggests that CUR can be used to treat arthritis with minimal side effects (Kunnumakkara et al. 2017). Furthermore, CUR adjuvant therapy has shown pronounced therapeutic effects in primary knee OA (Kunnumakkara et al. 2017). CUR, which is used as a traditional herbal medicine, has many health benefits, exhibiting anti-inflammatory, antioxidant, and anticancer properties (Zhang et al. 2018). Therefore, we explored the potential anti-inflammatory and cartilage protective effects of CUR by detecting inflammation, ROS generation, and matrix degradation.

In this study, the expression of IL-1β-induced inflammatory mediators (e.g., iNOS, COX-2, and IL-6) was reduced in human TMJ chondrocytes pretreated with CUR. MMPs, and aggrecanases are the main enzymes participating in ECM degradation (Clutterbuck et al. 2010). As expected, CUR treatment significantly reduced the expression of catabolic mediators, including MMP-1, MMP-3, MMP-9, MMP-13, ADAMTS-4, and ADAMTS-5. In contrast, CUR treatment enhanced the expression of the anabolic cartilage factors, which protected human TMJ chondrocytes from matrix degradation.

Recent reports have indicated that oxidative stress and ROS production are important factors in TMJ OA progression (Lepetsos and Papavassiliou 2016). In previous reports, excessive oxidative stress was shown to activate apoptosis and necrosis signaling pathways in chondrocytes (Lepetsos and Papavassiliou 2016). The present study showed that IL-1β stimulation enhanced ROS level in chondrocytes and that CUR treatment inhibited IL-1β-induced oxidative stress.

Nrf2 has been reported to play a significant role in regulating inflammation and antioxidative stress via the HO-1-NQO-1-GCLC-SOD2 signaling axis (Motohashi and Yamamoto 2004). Furthermore, Nrf2 is an important factor involved in reducing inflammation and oxidative stress in many inflammation-related diseases, including cancer and arthritis (Motohashi and Yamamoto 2004). Our results indicate that CUR effectively activates Nrf2 and Nrf2-dependent ARE factors, such as HO-1, NQO-1, GCLC, and SOD2, in TMJ chondrocytes in a dose-dependent manner. Furthermore, the expression levels of IL-6, iNOS, COX-2, and MMP-13 were inhibited by CUR treatment in IL-1β-stimulated TMJ chondrocytes. Moreover, previous studies showed pronounced cartilage destruction in Nrf2 knockout OA model rats, suggesting that the activation of Nrf2 has cartilage protection potential (Moussavi-Harami et al. 2009). Hence, to validate our hypothesis that CUR exerts anti-inflammatory and cartilage protective effects that require Nrf2 pathway activation, we ablated Nrf2 expression using specific siRNA in human TMJ chondrocytes. As expected, Nrf2 silencing distinctly abolished the CUR-induced suppression of inflammatory mediators and the enhancement of cartilage anabolic factor expression in human TMJ chondrocytes. These results demonstrate that the Nrf2/ARE pathway is involved in the anti-inflammatory process. Studies have also shown that CUR can exert anti-inflammatory and cartilage protective effects through signaling pathways, including the AKT/mTOR, NF-κB, and P38MAPK pathways (Kunnumakkara et al. 2017; Zhang et al. 2016). The present study provides evidence that CUR also exert beneficial effects through the activation of Nrf2. Together, the results of the present study show that CUR exerts anti-inflammatory and cartilage protective effects in TMJ inflammatory chondrocytes in vitro via the activation of the ROS/Nrf2/HO-1-SOD2-NQO-1-GCLC signaling axis.

In the in vivo study, an intra-articular injection of CFA was used to establish a TMJ inflammatory model, and CUR was injected weekly as a treatment. Pathological changes, including cartilage erosion and proteoglycan loss, were observed in the TMJ inflammatory model. We found that CUR treatment reduced cartilage erosion and proteoglycan loss. In addition, the immunohistochemistry results showed that CUR treatment increased the Nrf2 protein level but reduced the iNOS, COX-2, IL-1β, MMP-9, and MMP-13 protein levels. These results indicate that Nrf2 is a key factor in the CUR-mediated protection against TMJ inflammation in vivo. Unlike traditional TMJ arthritis treatments, intra-articular injection of CUR can inhibit the progression of the disease, thereby slowing the development of TMJ arthritis.

In conclusion, our data indicate that CUR exerts anti-inflammatory, antioxidant, and cartilage-protective effects by inhibiting key molecular processes in TMJ inflammatory chondrocytes, including inflammation, oxidative stress, and matrix degradation. In addition, redox regulators play key roles in the anti-inflammatory and cartilage-protective effects of CUR. These findings demonstrate that CUR activates the ROS/Nrf2/HO-1-SOD2-NQO-1-GCLC signaling axis to reduce inflammation and oxidative stress in TMJ chondrocytes.

Abbreviations

IL-1β

Interleukin-1β

IL-6

Interleukin-6

MMP

Matrix metalloproteinase

ADAMTS

A disintegrin and metalloproteinase with thrombospondin motifs

COX-2

Cyclooxygenase-2

iNOS

Inducible nitric oxide synthase

COL2A1

Type 2 collagen

ACAN

Aggrecan

GCLC

Glutamate-cysteine ligase catalytic subunit

ROS

Reactive oxygen species

Nrf2

Nuclear factor (erythroid-derived 2)-Like 2

NQO-1

NAD(P)H: quinone oxidoreductase

HO-1

Heme oxygenase-1

SOD2

Superoxide dismutase 2

ECM

Extracellular matrix

Authors’ contributions

The specific contributions of the authors are as follows:

(1) Study conception and design: Chao Jiang, Ping Luo, Xian Li, Ping Liu, Yong Li, Jie Xu.

(2) Data analysis and interpretation: Chao Jiang, Ping Luo, Xian Li, Ping Liu, Yong Li, Jie Xu.

(3) Data collection and management: Chao Jiang, Ping Luo.

(4) Drafting of the article: Chao Jiang, Ping Luo.

(5) Review of the article for important intellectual content and article revision: Xian Li, Ping Liu, Yong Li, Jie Xu.

(6) Final approval of the article: Chao Jiang, Ping Luo, Xian Li, Ping Liu, Yong Li, Jie Xu.

(7) Agreement to be accountable for all aspects of the work: Chao Jiang, Ping Luo, Xian Li, Ping Liu, Yong Li, Jie Xu.

Funding

This work was supported by the National Natural Science Foundation of China (Grant No. 81800999), China Postdoctoral Science Foundation (Grant No. 2019 M653355), Scientific and Technological Research Program of Chongqing Municipal Education Commission (Grant No. KJQN201800414), and Program for Innovation Team Building at Institutions of Higher Education in Chongqing in 2016, Chongqing Medical Research Project (No. 2016MSXM046).

Compliance with ethical standards

All animal experiments were performed according to the terms of the Animal Committee.

Conflict of interests

The authors declare that they have no competing interests.

Ethical approval

Ethics approval for the collection of human TMJ cartilage samples was obtained from the Committee of Chongqing Medical University.

Ethical statement

The collection of human TMJ cartilage samples conformed to the Declaration of Helsinki.

Informed consent

All the participants expressed informed consent.