REAGENT or RESOURCE	SOURCE	IDENTIFIER
Antibodies
HRP goat anti-mouse IgM	Southern Biotech	1020-05; RRID: AB_2794201
HRP goat anti-mouse IgG1	Southern Biotech	1070-05; RRID: AB_2650509
HRP goat anti-mouse IgG2a	Southern Biotech	1080-05; RRID: AB_2734756
HRP goat anti-mouse IgG2b	Southern Biotech	1090-05; RRID: AB_2794521
HRP goat anti-mouse IgG2c	Southern Biotech	1079-05; RRID: AB_2794466
HRP goat anti-mouse IgG3	Southern Biotech	1100-05; RRID: AB_2794573
HRP goat anti-mouse IgG	Southern Biotech	1030-05; RRID: AB_2619742
Biotin-conjugated goat anti-mouse IgM	Southern Biotech	RRID: AB_2794242
Biotin-conjugated goat anti-mouse IgG	Southern Biotech	RRID: AB_2794296
anti-CHIKV CHK-11 mAb	Diamond laboratory	Pal et al., 2013
HRP-conjugated goat anti-mouse IgG	Southern Biotech	RRID: AB_2619742
Bacterial and Virus Strains
Influenza A/CA/04/09 (H1N1)	Laboratory of Yoshihiro Kawaoka	N/A
Mouse-adapted SARS-CoV MA15	Roberts et. al, 2007	N/A
Mouse-adapted A/Hong Kong/01/68 (H3N2)	Haller et. al, 1979	NA
CHIKV strain 181/25	Dermody laboratory	Mainou et al., 2013
CHIKV strain SL15649	Morrison et. al, 2011	icCHIKVSL15649
Biological Samples
C57BL6/J immune sera	This paper	N/A
Chemicals, Peptides, and Recombinant Proteins
RNAlater	Applied Biosystems/Ambion	AM7021
Trizol	Invitrogen	15596018
HA antigen	BEI Resources	NR13691
SARS S protein	BEI Resources	NR722
TMB substrate	ThermoFisher Scientitic	34028
OPD powder	Sigma	P9029
KPL TrueBlue Substrate	SeraCare	5510-0030
Streptavidin-HRP	Southern Biotech	7100-05
Critical Commercial Assays
miRNeasy mini kit	QIAGEN	217004
RNeasy Midi Kit	QIAGEN	75144
SENSE mRNA-Seq Library Prep Kit for Ion Torrent	Lexogen	00624
Ion Torrent PGM 314 chip	Life Technologies	4482261
High Sensitivity DNA chip	Life Technologies	50674626
Ion OneTouch 2 System	Life Technologies	INS1005527
Ion P1 Chip	Life Technologies	A26770
Whole mouse genome microarray	Agilent	026655
Deposited Data
Antibody response to IAV A/CA/04/09 in CC-F1s	This paper; Mendeley Data	https://doi.org/10.17632/kxr3t8n384.1
Antibody response to SARS-CoV in CC-F1s	This paper; Mendeley Data	https://doi.org/10.17632/kxr3t8n384.1
Antibody response to CHIKV in CC-RIs	This paper; Mendeley Data	https://doi.org/10.17632/kxr3t8n384.1
RNaseq raw reads and normalized count matrix (lung)	GEO (Gene Expression Omnibus)	GSE136748
Gene Expression array normalized expression matrix (blood)	GEO (Gene Expression Omnibus)	GSE110384
Experimental Models: Cell Lines
Vero E6 cells	ATCC	CRL-1586
MDCK cells	ATCC	CCL-34
MDCK II cells	ATCC	CRL-2936
HEK293T cells	ATCC	CRL-3216
Vero cells	ATCC	CCL-81
Experimental Models: Organisms/Strains
Collaborative Cross Mice	UNC SGCF	Supplemental file
Oligonucleotides
Forward primer for detection of IAV viral load: GACCRATCCTGTCACCTCTGAC	Ngaosuwankul et al., 2010	WHO_CDC_Influenza A_pandemic H1N1 test
Reverse primer for detection of IAV viral load: AGGGCATTYTGGACAAAKCGTCTA	Ngaosuwankul et al., 2010	WHO_CDC_Influenza A_pandemic H1N1 test
Probe for detection of IAV viral load: TGCAGTCCTCGCTCACTGGGCACG (FAM)	Ngaosuwankul et al., 2010	WHO_CDC_Influenza A_pandemic H1N1 test
Eukaryotic 18S rRNA Endogenous Control (VIC/MGB probe, primer limited)	Applied Biosystems	4319413E
Software and Algorithms
DOQTL	Gatti et al., 2014	N/A
R	R Development Core Team, 2008	N/A
cckit	https://github.com/kenoll/cckit	N/A
Variant Effect Predictor	McLaren et al., 2010	N/A
C.T.L. Biospot Software	Cellular Technology Limited	V6.6.8
FastQC	Andrews, 2010	http://www.bioinformatics.babraham.ac.uk/projects/fastqc/
Trimgalore	Krueger, 2012	http://www.bioinformatics.babraham.ac.uk/projects/trim_galore/
STAR aligner	Dobin et. al, 2016	http://github.com/alexdobin/STAR
RsubRead	Liao et. al, 2019	http://bioconductor.org/packages/release/bioc/html/Rsubread.html
DESeq2	Love et. al, 2014	http://bioconductor.org/packages/release/bioc/html/DESeq2.html
sva	Leek, 2014	http://bioconductor.org/packages/release/bioc/html/sva.html
Other
MRCA probabilities	Srivastava et al., 2017	N/A