Official websites use .gov
A
.gov website belongs to an official
government organization in the United States.
Secure .gov websites use HTTPS
A lock (
) or https:// means you've safely
connected to the .gov website. Share sensitive
information only on official, secure websites.
Details of the Forward and Reverse Primers Used for the Beta Actin qPCR Analysis, Including the amplicon Length, Melt Temperature, 5′-3′ Sequence, and NCBI Accession Number
| Primer | Amplicon length | Temperature (°C) | Sequence (5′-3′) | Gene | Accession number | Reference |
|---|---|---|---|---|---|---|
| Forward | 108 | 59.9 | ACAATGTGGCCGAGGACTTT | Beta actin | NM_001101.3 | Own design primer BLAST3 |
| Reverse | 59.7 | TGGGGTGGCTTTTAGGATGG |
qPCR, quantitative real-time polymerase chain reaction.
