Key resources table.
| Reagent type (species) or resource |
Designation | Source or reference | Identifiers | Additional information |
|---|---|---|---|---|
| Strain, strain background (R. norvegicus, male) | BluHsd:LE Long-Evans (blue spruce) | Envigo | RRID:RGD_5508398 | |
| Strain, strain background (M. musculus, male and female) | Igf2r-floxed mice | Dr. David Skaar (NC State University | MGI Cat# 3795370, RRID:MGI:3795370 | C57Bl/6J background, homozygotes used in experiments |
| Antibody | anti-Human IGF-II R (goat polyclonal) | R and D Systems | Cat# AF2447, RRID:AB_442153 | 5 ng/µL or 50 ng/µL |
| Antibody | anti-GFAP (chicken polyclonal) | Abcam | Cat# ab4674, RRID:AB_304558 | IF (1:5000) |
| Antibody | anti-Iba1 (rabbit polyclonal) | Wako | Cat# 019–19741, RRID:AB_839504 | IF (1:5000) |
| Antibody | anti-CaMKIIα (mouse monoclonal) | Millipore | Cat# 05–532, RRID:AB_309787 | IF (1:1000) |
| Antibody | anti-IGF2R (rabbit monoclonal) | Abcam | Cat# ab124767, RRID:AB_10974087 | IF (1:1000), WB (1:1000) |
| Antibody | anti-GFP (chicken polyclonal) | Aves Labs | Cat# GFP-1020, RRID:AB_10000240 | IF (1:1000) |
| Antibody | anti-Arc (rabbit polyclonal) | Synaptic systems | Cat# 156 003, RRID:AB_887694 | IF (1:2000) |
| Antibody | anti-Egr1 (rabbit monoclonal) | Cell Signaling Technology | Cat# 4153, RRID:AB_2097038 | IF (1:1000), WB (1:1000) |
| Antibody | anti-c-Fos (rabbit monoclonal) | Cell Signaling Technology | Cat# 2250, RRID:AB_2247211 | IF (1:500) |
| Antibody | anti-Cre (rabbit monoclonal) | Cell Signaling Technology | Cat# 15036, RRID:AB_2798694 | WB (1:1000) |
| Antibody | anti-β-actin (mouse monoclonal) | Santa Cruz Biotechnology | Cat# sc-47778 HRP, RRID:AB_2714189 | WB (1:10000) |
| Sequence-based reagent | Igf2r forward | NM_012756.2 | Primers | TTGCCCTCCAGAAACGGAAG |
| Sequence-based reagent | Igf2r reverse | NM_012756.2 | Primers | TACACCACAGTTTCGCTCGT |
| Sequence-based reagent | Arc forward | NM_019361.1 | Primers | CCCTGCAGCCCAAGTTCAAG |
| Sequence-based reagent | Arc reverse | NM_019361.1 | Primers | GAAGGCTCAGCTGCCTGCTC |
| Sequence-based reagent | c-Fos forward | NM_022197.2 | Primers | CCCTGCAGCCCAAGTTCAAG |
| Sequence-based reagent | c-Fos reverse | NM_022197.2 | Primers | GAAGGCTCAGCTGCCTGCTC |
| Sequence-based reagent | Egr1 forward | NM_012551.2 | Primers | ACCTACCAGTCCCAACTCATC |
| Sequence-based reagent | Egr1 reverse | NM_012551.2 | Primers | GACTCAACAGGGCAAGCATAC |
| Sequence-based reagent | Gapdh forward | NM_017008.4 | Primers | GAACATCATCCCTGCATCCA |
| Sequence-based reagent | Gapdh reverse | NM_017008.4 | Primers | CCAGTGAGCTTCCCGTTCA |
| Peptide, recombinant protein | Recombinant mouse IGF-II | R and D Systems | Cat# 792 MG | |
| Commercial assay or kit | RNeasy Plus Universal Mini Kit | Qiagen | Cat# 73404 | |
| Commercial assay or kit | QuantiTect Reverse Transcription Kit | Qiagen | Cat# 205311 | |
| Commercial assay or kit | iQ SYBR Green Supermix | Bio-Rad | Cat# 107–8882 | |
| Software, algorithm | ImageJ | National Institutes of Health | RRID:SCR_003070 | |
| Software, algorithm | Leica Application Suite X | Leica | RRID:SCR_013673 |