Skip to main content
. 2020 Apr 27;43(2):e20180351. doi: 10.1590/1678-4685-GMB-2018-0351

Table 2. miRNAs more abundantly detected by the SOLiD platform.

miRNA (hsa-miR) Fold change p-value Reads/million Reads/million Cell line Sequence
  (SOLiD:PGM)   (SOLiD) (PGM)    
150-5pa N.A. 0.0084 26.02 0 C5.2 ucucccaacccuuguaccagug
  26.36x 0.0028 23.99 0.91 HB4a  
142-5pb N.A. 0.0302 12.57 0 HB4a cauaaaguagaaagcacuacu
  10.7x 0.1141 12.01 1.12 C5.2  
223-3pb N.A. 0.0340 12.55 0 C5.2 Ugucaguuugucaaauacccca
  N.A. 0.1535 5.14 0 HB4a  
3607-5p1 1731x 0.0367 2094.4 1.21 C5.2 gcaugugaugaagcaaaucagu
  1968x 0.0286 5353.8 2.73 HB4a  
4284a 118.8x 0.0002 287.57 2.42 C5.2 gggcucacaucaccccau
  14.39x 0.0042 471.19 32.75 HB4a  
199a-3p/ 199b-3pa 17.6x 0.0429 21.23 1.21 C5.2 acaguagucugcacauugguua
  12.86x 0.0274 35.12 2.73 HB4a  
1249b 16.13x 0.0180 39.03 2.42 C5.2 acgcccuucccccccuucuuca
  N.A. 0.2007 43.98 0 HB4a  
181b-3pb 13.18x 0.0424 23.99 1.82 HB4a cucacugaacaaugaaugcaa
  1.69x 0.7040 2.05 1.21 C5.2  
29a-3p/ 29c-3pa 4.19x 0.0266 11927 2849 C5.2 uagcaccaucugaaaucgguua
  10.48x 0.0062 37988 3622 HB4a uagcaccauuugaaaucgguua
103a-3pa 8.41x 0.0060 128212 15233 C5.2 agcagcauuguacagggcuauga
  4.03x 0.0406 70822 17552 HB4a  
152-5pb 8.07x 0.0202 102.8 12.74 HB4a agguucugugauacacuccgacu
  7.78x 0.0517 28.30 3.64 C5.2  
4521b 5.61x 0.0200 217.73 38.79 C5.2 gcuaaggaaguccugugcucag
  2.99 0.0842 261.30 87.34 HB4a  
301bb 4.39x 0.0270 532.68 121.23 C5.2 cagugcaaugauauugucaaagc
  2.06x 0.1569 589.98 286.58 HB4a  
107b 3.82x 0.0324 3831.24 1000.16 C5.2 agcagcauuguacagggcuauca
  2.55x 0.0999 3918.28 1535.69 HB4a  

a miRNAs preferentially represented by the SOLiD platform for both cell lines; b significant differential representation seen for only one of the cell lines. For each miRNA row, the top line contains the lower p-value for differential representation between SOLiD and PGM.